Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (900 - 999) out of 1979 markers

MlSTS5073Mimulus unigene:MlU528Phytome id:
 Arabidopsis homolog:At4g33680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACAGCAATTCCCAAAGAGCOvergo seq fw:
Reverse primer:CAAGCTTCCAGAACATTCTCCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5074Mimulus unigene:MlU529Phytome id:
 Arabidopsis homolog:At5g63220
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAACATCTCAGGCATGGOvergo seq fw:CCCCAAACATCTCAGGCATGGCAT
Reverse primer:GGCTCTAGGTAATCTGAGAGATGCOvergo seq rv: GGTGTACAACGTAGAAATGCCATG
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5075Mimulus unigene:MlU532Phytome id:
 Arabidopsis homolog:At4g33680
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTGGGATACAGGAAGACGOvergo seq fw:CCTCGGAATTGGTGACACAACCGA
Reverse primer:TCGTTAGTTGCTCTCTTGTTGCOvergo seq rv: AACTTCTGGAATTGGCTCGGTTGT
Tm:59.5Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5076Mimulus unigene:MlU535Phytome id:
 Arabidopsis homolog:At3g46970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGCCTGTGTCTCTTCTTGCOvergo seq fw:
Reverse primer:GTCAGAAAGTCCAGGGTTGCOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5077Mimulus unigene:MlU541Phytome id:
 Arabidopsis homolog:At5g15220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGACATGAATCCACCTTCGOvergo seq fw:
Reverse primer:GATCTGGTTGCAAATTCACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5078Mimulus unigene:MlU547Phytome id:
 Arabidopsis homolog:At1g65410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATTGTCGACTTGCCTGTCCOvergo seq fw:
Reverse primer:CACGAGAAATAGAAGGGTTTCGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5079Mimulus unigene:MlU553Phytome id:
 Arabidopsis homolog:At5g63160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGCATCGTTACCTCTTCGOvergo seq fw:
Reverse primer:GCACGATGTGAATGTGTGCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5080Mimulus unigene:MlU559Phytome id:
 Arabidopsis homolog:At4g30840
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGTTTTCGTGATGGATGGOvergo seq fw:ACGTGTGTCCCATGCAAATACAGT
Reverse primer:GGATGGGAGGGTTAATTTGGOvergo seq rv: AGGAGGCTCTTCTGGTACTGTATT
Tm:60.4Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5081Mimulus unigene:MlU563Phytome id:
 Arabidopsis homolog:At4g11050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGTTAGACCCCAAAGAGGOvergo seq fw:
Reverse primer:CGGCTATAATCAGCTTCTTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5082Mimulus unigene:MlU573Phytome id:
 Arabidopsis homolog:At1g51760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTCCGATCCCATCAAAGGOvergo seq fw:
Reverse primer:TTGTCTCTCGAGAAGCTGACCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5083Mimulus unigene:MlU578Phytome id:
 Arabidopsis homolog:At3g03773
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGATGTAAGACGAAGACTGGOvergo seq fw:
Reverse primer:AAAGCATCCCTTCGTCACCOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5084Mimulus unigene:MlU580Phytome id:
 Arabidopsis homolog:At5g07030
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGTAGCACGTGTCGAATCCOvergo seq fw:TTCTCGGGTTTTTCAGCAACTGGG
Reverse primer:CACCCAGTTGCTGAAAAACCOvergo seq rv: AAGAGGATCCGAACCACCCAGTTG
Tm:59.2Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5085Mimulus unigene:MlU584Phytome id:
 Arabidopsis homolog:At2g05840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGGATCACACTTGAAGAGCOvergo seq fw:
Reverse primer:TTGATCAGACAAGCGTCACCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5086Mimulus unigene:MlU585Phytome id:
 Arabidopsis homolog:At2g05710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATGAGGTGATGGCTAGGGOvergo seq fw:
Reverse primer:AGCCAAGTGTTTCTGCATCCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5087Mimulus unigene:MlU587Phytome id:
 Arabidopsis homolog:At3g21190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTAGGCGGTCAATCATGGOvergo seq fw:
Reverse primer:TTCTGATGCAGTAGTGGTTGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5088Mimulus unigene:MlU588Phytome id:
 Arabidopsis homolog:At4g34670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGCAACCATTATCTCATGCOvergo seq fw:
Reverse primer:GAAGCATCGTGTGTTTGAGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5089Mimulus unigene:MlU590Phytome id:
 Arabidopsis homolog:At5g19330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGAGCAATATGTGAATAATCCOvergo seq fw:
Reverse primer:CATGCCTCAATGACAATGCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5091Mimulus unigene:MlU599Phytome id:
 Arabidopsis homolog:At3g02870
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTCTGTGGCACCAAAAGCOvergo seq fw:AGATTCAACGCACAAGAGCCACTC
Reverse primer:GGAGGATTTCTTGGCTATGGOvergo seq rv: TGAGGTCCCTTCGAATGAGTGGCT
Tm:60.1Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5092Mimulus unigene:MlU601Phytome id:
 Arabidopsis homolog:At1g73960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGACCCATCTGTTTTTCCOvergo seq fw:
Reverse primer:TGGTTGTTGGATGGTCTTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5093Mimulus unigene:MlU604Phytome id:
 Arabidopsis homolog:At1g02080
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTATCATCGACGGGTTTTGGOvergo seq fw:GCCCTCTGTGTCGAGATCCATGAT
Reverse primer:CCCCTTCTCATTCACAATCGOvergo seq rv: CATTTTCCAGTCGTTGATCATGGA
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5094Mimulus unigene:MlU611Phytome id:
 Arabidopsis homolog:At3g02570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTAACCACAGCGAAGTTGCOvergo seq fw:
Reverse primer:GCCTTGGAAAGGTGTTAAAGCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5095Mimulus unigene:MlU624Phytome id:
 Arabidopsis homolog:At2g39730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCTCGTCGACACCTTCCOvergo seq fw:
Reverse primer:TCGTCACTTCTTGCAGTTGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5096Mimulus unigene:MlU628Phytome id:
 Arabidopsis homolog:At1g26460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATACATCGCCTCCTGACCOvergo seq fw:
Reverse primer:TTGGCTGTGCAAATGTATGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5097Mimulus unigene:MlU629Phytome id:
 Arabidopsis homolog:At1g60780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCCATGGAAGAGACTGATACCOvergo seq fw:
Reverse primer:CACTGCAACTAATGTTGAAATCGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5098Mimulus unigene:MlU632Phytome id:
 Arabidopsis homolog:At3g27000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCCTGGCCTTCCTAGTCGOvergo seq fw:
Reverse primer:GAACCCTTAGGCCTTTTTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5099Mimulus unigene:MlU637Phytome id:
 Arabidopsis homolog:At1g08510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACGAAATAGGGGCTGATCGOvergo seq fw:
Reverse primer:TCTTCCCAGATGCAGCTACCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5100Mimulus unigene:MlU645Phytome id:
 Arabidopsis homolog:At5g55120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTCAGACAGAGAAACCTCAGCOvergo seq fw:
Reverse primer:TACTTAGCAACGCCCTTTCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5101Mimulus unigene:MlU658Phytome id:
 Arabidopsis homolog:At5g53000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTAAATCGAGCCCTTGTTGCOvergo seq fw:
Reverse primer:GGTAGGGGAAGATGACATGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5102Mimulus unigene:MlU666Phytome id:
 Arabidopsis homolog:At4g03280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAACAAACACCACCTTCCOvergo seq fw:
Reverse primer:CCTGCAAAGGATGCATTAGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5104Mimulus unigene:MlU686Phytome id:
 Arabidopsis homolog:At4g36480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACACGGAACCGATATTTCTCCOvergo seq fw:
Reverse primer:GAAGGGTGATCTCGTTGTCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5105Mimulus unigene:MlU701Phytome id:
 Arabidopsis homolog:At4g38430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATAGTGTTTCAGCCCGTTGGOvergo seq fw:
Reverse primer:GTGCAGGGATTGCACTAACCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5106Mimulus unigene:MlU709Phytome id:
 Arabidopsis homolog:At3g04400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTGGCTGCACTAGCAATCCOvergo seq fw:
Reverse primer:ATGCCTGCTGTCATTGTCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5107Mimulus unigene:MlU738Phytome id:
 Arabidopsis homolog:At5g60040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGTCATGGGCATTGAAGGOvergo seq fw:
Reverse primer:CCTAACTTTAAGCATCCCAGTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5108Mimulus unigene:MlU744Phytome id:
 Arabidopsis homolog:At1g20220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTACCTTGTCCACCCCTACCOvergo seq fw:
Reverse primer:CCAGGTGAAGGTGTCTACCGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5109Mimulus unigene:MlU754Phytome id:
 Arabidopsis homolog:At1g19580
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGGATTTCCTCCCCATACCOvergo seq fw:GTGAGCTTCCTCAGGAATTTGGCT
Reverse primer:GGTGCAACTTTGCTTGATGGOvergo seq rv: TATGGGGAGGAAATCCAGCCAAAT
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5110Mimulus unigene:MlU758Phytome id:
 Arabidopsis homolog:At4g17510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATAAAGTGACGGACCACTGCOvergo seq fw:
Reverse primer:ACAATCGGTAATGCCTGTGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5111Mimulus unigene:MlU769Phytome id:
 Arabidopsis homolog:At2g28000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACCGAGACTGAGCTTGAGGOvergo seq fw:
Reverse primer:GATTTCGGCTTAGCTTTCTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5112Mimulus unigene:MlU777Phytome id:
 Arabidopsis homolog:At5g03250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACACGCTCCCTCATATCGOvergo seq fw:
Reverse primer:CGACGTGTATCTTGCTGAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5113Mimulus unigene:MlU788Phytome id:
 Arabidopsis homolog:At5g49460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGAGCACCAGAGACACAGGOvergo seq fw:
Reverse primer:AGCACAGCAATCAAGAGTGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5114Mimulus unigene:MlU796Phytome id:
 Arabidopsis homolog:At4g12800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGGATCACCGTTGATTGGOvergo seq fw:
Reverse primer:TTAACCCTAAGGGCATCTCCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5115Mimulus unigene:MlU802Phytome id:
 Arabidopsis homolog:At1g52330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGGGTAGCAGTTTTGACGOvergo seq fw:
Reverse primer:TTCGGAACATTGACTTCTACTCCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5116Mimulus unigene:MlU807Phytome id:
 Arabidopsis homolog:At2g44350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTACTGGGGAAGTTGTTTAGCOvergo seq fw:
Reverse primer:TCCGTTTCCGAAATTACAGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5117Mimulus unigene:MlU819Phytome id:
 Arabidopsis homolog:At1g09780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACATGGTTGGACACACTGGOvergo seq fw:
Reverse primer:TGTAGGTTCATGACGGTTGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5118Mimulus unigene:MlU820Phytome id:
 Arabidopsis homolog:At5g20290
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)7 0.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTCTCCATTTCACATTGCOvergo seq fw:
Reverse primer:GTGATTCCATGCACAAGAGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5119Mimulus unigene:MlU821Phytome id:
 Arabidopsis homolog:At1g13950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAATCGACATCTTCACTTCCOvergo seq fw:
Reverse primer:ACAAGGTCCTTTCCCTCAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5120Mimulus unigene:MlU823Phytome id:
 Arabidopsis homolog:At1g65930
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCAGCCTCAATTGTCTTGCOvergo seq fw:AGTTCCATGAGCAGCTTCAGCCTC
Reverse primer:ACGAAGCAAAATGGAAATCGOvergo seq rv: CGATGGCAAGACAATTGAGGCTGA
Tm:59.0Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5121Mimulus unigene:MlU830Phytome id:
 Arabidopsis homolog:At5g47730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCGATATCTTCTTCATCAGCOvergo seq fw:
Reverse primer:TGCTCCATATGTCTTTTCTGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5122Mimulus unigene:MlU846Phytome id:
 Arabidopsis homolog:At5g57655
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACCTGAAGGTTCTAATTTGGOvergo seq fw:
Reverse primer:AGTTGCATGTAGCCCAGAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5123Mimulus unigene:MlU848Phytome id:
 Arabidopsis homolog:At1g11860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTACCCTCGGATTTCTCGOvergo seq fw:
Reverse primer:AAAGCGTTCACATCCAAAGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5124Mimulus unigene:MlU851Phytome id:
 Arabidopsis homolog:At2g29940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGTTGCTGGGTTGTAGCCOvergo seq fw:
Reverse primer:GTGGAGCTTGTTGCAAATCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5125Mimulus unigene:MlU852Phytome id:
 Arabidopsis homolog:At5g23250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACGAGACTGATCCACAGCOvergo seq fw:
Reverse primer:GTTTCAGCTTTGGCTTCTGCOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5127Mimulus unigene:MlU883Phytome id:
 Arabidopsis homolog:At3g04240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAAATTCCAAGTCATTCTCGOvergo seq fw:
Reverse primer:TTGGGCAGGTCTACCTATGGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5128Mimulus unigene:MlU885Phytome id:
 Arabidopsis homolog:At5g46630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGGTGTCAAATCTCAGAGCOvergo seq fw:
Reverse primer:CAACTTTACCTGCGACATGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5129Mimulus unigene:MlU922Phytome id:
 Arabidopsis homolog:At5g60640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTTGGAAACAATTTTGACGOvergo seq fw:
Reverse primer:TTGAAGCTTGAAAGGGATCGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5130Mimulus unigene:MlU955Phytome id:
 Arabidopsis homolog:At3g52590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGCCCACATTTCTTCTTCCOvergo seq fw:
Reverse primer:CATCTGGTTTTGAGGCTTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5131Mimulus unigene:MlU969Phytome id:
 Arabidopsis homolog:At3g60820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGACTATCTCCAGCTTGTCTCCOvergo seq fw:
Reverse primer:GGTGGGATACAGCTCTCAGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5132Mimulus unigene:MlU971Phytome id:
 Arabidopsis homolog:At3g11410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGATCGACGGAGAGAGGOvergo seq fw:
Reverse primer:CGGGAGGAGGAGAGATATGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5133Mimulus unigene:MlU978Phytome id:
 Arabidopsis homolog:At5g39850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGCGTTGTTCCTGATACGOvergo seq fw:
Reverse primer:GGTGCACGTATCGTTTTATCGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5134Mimulus unigene:MlU979Phytome id:
 Arabidopsis homolog:At2g43360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCACTTCAACATTCTCAGGOvergo seq fw:
Reverse primer:GGCTTGGTGAAGCAGAGGOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5135Mimulus unigene:MlU983Phytome id:
 Arabidopsis homolog:At1g76490
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 34.10cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAGGCGACTCTTTACTTGCOvergo seq fw:
Reverse primer:GTCAGCAGTCAACTGGATCGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5136Mimulus unigene:MlU995Phytome id:
 Arabidopsis homolog:At1g12000
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGGCCTTGTCGTAATTGGOvergo seq fw:AAAAAGCCATTCAAAGTCGTCAAC
Reverse primer:GACATTCCCAATCATTTCTGCOvergo seq rv: CGGAGCTAGGTGGACCGTTGACGA
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5137Mimulus unigene:MlU1002Phytome id:
 Arabidopsis homolog:At5g65810
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)1 3.70cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAACCCTCGATAGCTCAGGOvergo seq fw:GCTGGCTTGTACGATTTCTTGGCT
Reverse primer:GGCAGGAGTGGTGACATAGCOvergo seq rv: AGTTTGAACAGGCAGCAGCCAAGA
Tm:58.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5138Mimulus unigene:MlU1009Phytome id:
 Arabidopsis homolog:At1g76020
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGTTAAACGTGGCCTTTCCOvergo seq fw:ATAGTAGCGAAGGGCTTTCTTGAG
Reverse primer:TCTCCACACTTTCCCTTTGCOvergo seq rv: TGATTCATGGCCCCCTCTCAAGAA
Tm:59.0Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5139Mimulus unigene:MlU1014Phytome id:
 Arabidopsis homolog:At5g64560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAAACACACGGTTCCAGAGCOvergo seq fw:
Reverse primer:GGAACTTGAAATGCTTCTCGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5140Mimulus unigene:MlU1015Phytome id:
 Arabidopsis homolog:At1g06260
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGCTTTTAAGGCGTCTTCGOvergo seq fw:TCTTGTTGATGCCTTCTACTGCTG
Reverse primer:AGACACATCATCACGCTTCGOvergo seq rv: GCGTTCTCAGCAGTAGCAGCAGTA
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5141Mimulus unigene:MlU1021Phytome id:
 Arabidopsis homolog:At3g56990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACTCATCACGCTCAAAGTCCOvergo seq fw:
Reverse primer:GCTCAAAGTTTGGCTGATCCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5142Mimulus unigene:MlU1027Phytome id:
 Arabidopsis homolog:At3g02050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATCTTGGCCATTTTTCTGCOvergo seq fw:
Reverse primer:TTCACACGAGGGAAACAACCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5143Mimulus unigene:MlU1033Phytome id:
 Arabidopsis homolog:At4g16130
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTTCGAAGGCAATTTCTGCOvergo seq fw:CCCTCGAAAACGATCGGCAGATAT
Reverse primer:CAGAGCAGCCACTAGACATCCOvergo seq rv: ACAAAGGTGCAACTGGATATCTGC
Tm:59.5Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5144Mimulus unigene:MlU1035Phytome id:
 Arabidopsis homolog:At4g21710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCTCCAAGTCCTATGATGCOvergo seq fw:
Reverse primer:TTGTAGCCATTTTCTCTTGTGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5145Mimulus unigene:MlU1037Phytome id:
 Arabidopsis homolog:At2g21790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTTCGGGTTCAAGACATTGGOvergo seq fw:
Reverse primer:TCTCAACATGGGCAGTAAACCOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5146Mimulus unigene:MlU1041Phytome id:
 Arabidopsis homolog:At1g08710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACATTTAACGCAACAGAAGCOvergo seq fw:
Reverse primer:CCAACGCCAAATTTAAGAGCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5147Mimulus unigene:MlU1048Phytome id:
 Arabidopsis homolog:At1g54460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCCATGTTCTTCCTCAGCOvergo seq fw:
Reverse primer:AGAATCACAGTTCCGGTTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5148Mimulus unigene:MlU1050Phytome id:
 Arabidopsis homolog:At3g12360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACAGACTGCTCTGCACATGGOvergo seq fw:
Reverse primer:CTCAGCTCCTTTGCGATACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5149Mimulus unigene:MlU1059Phytome id:
 Arabidopsis homolog:At4g15470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTCCTCGGGCTCTTTACCOvergo seq fw:
Reverse primer:CATATATGGCAGTAGAGGTAGATCCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5150Mimulus unigene:MlU1066Phytome id:
 Arabidopsis homolog:At1g24260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTGAGCTGGTTGTCTTCCOvergo seq fw:
Reverse primer:TGGTCCTTTGAACAGCAAGGOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5151Mimulus unigene:MlU1077Phytome id:
 Arabidopsis homolog:At5g39600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTCTCTTCTGCTTTCTTCGOvergo seq fw:
Reverse primer:TCGTGCATGGAGTTTTTGGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5152Mimulus unigene:MlU1080Phytome id:
 Arabidopsis homolog:At5g45550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACGGAAGAGAGTTGTGCOvergo seq fw:
Reverse primer:TTTCACAGTCTGACCATCAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5153Mimulus unigene:MlU1081Phytome id:
 Arabidopsis homolog:At1g09210
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTGGTCGGTCTCACATGGOvergo seq fw:
Reverse primer:GGAAAATGGAACGGAGAACCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5154Mimulus unigene:MlU1089Phytome id:
 Arabidopsis homolog:At4g05180
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACAGAACATCACTCAATGCOvergo seq fw:
Reverse primer:AGCGAGAGACTTTGGACTGCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5155Mimulus unigene:MlU1090Phytome id:
 Arabidopsis homolog:At3g06650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTTCCAAAGACGACTTCCOvergo seq fw:
Reverse primer:CAAACTCCATTGGAATCATGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5156Mimulus unigene:MlU1094Phytome id:
 Arabidopsis homolog:At5g14710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTAATTGCCGAGCACAAGCOvergo seq fw:
Reverse primer:CGTTATTGCAACTCAGATTGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5157Mimulus unigene:MlU1114Phytome id:
 Arabidopsis homolog:At3g07890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCATAAAAACCACTCTGTGCOvergo seq fw:
Reverse primer:GGACATTTCCAGGTCACTCGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5158Mimulus unigene:MlU1138Phytome id:
 Arabidopsis homolog:At1g79610
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAAGATCGTGAACTGATTGCOvergo seq fw:GGGGTGAGATAGTTCCTATCCAGT
Reverse primer:GACATTGCCATGGAACAGCOvergo seq rv: CTGCATCTTTTACTGCACTGGATA
Tm:59.7Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5159Mimulus unigene:MlU1155Phytome id:
 Arabidopsis homolog:At5g03620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCGCCTAACTCCTTTACGOvergo seq fw:
Reverse primer:AGGGGATTCTCACAGTTTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5160Mimulus unigene:MlU1184Phytome id:
 Arabidopsis homolog:At2g37250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGGCTGCGATAGAAATCCOvergo seq fw:
Reverse primer:GGAGAAACGAAAGGAGAATCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5161Mimulus unigene:MlU1187Phytome id:
 Arabidopsis homolog:At1g73230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTCTGGAACTGTTCTGCOvergo seq fw:
Reverse primer:GAATAGGAGTGAACGCCATACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5162Mimulus unigene:MlU1192Phytome id:
 Arabidopsis homolog:At3g54230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACTTTCTTCGGTTGATGGOvergo seq fw:
Reverse primer:GTTCGTCGTCAGCTTTTGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5163Mimulus unigene:MlU1199Phytome id:
 Arabidopsis homolog:At4g24820
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAACTCTTCCCCTATGACACCOvergo seq fw:TCGCCTTCGGGACGAGGTTTTCAA
Reverse primer:CCAAGAACTGGGCATAAACGOvergo seq rv: GTTGCTGATGATGAAGTTGAAAAC
Tm:60.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5164Mimulus unigene:MlU1202Phytome id:
 Arabidopsis homolog:At5g14780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 33.60cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTGCCAATTCTCCATCCOvergo seq fw:AATACCTCTCCAACATGTCTTTCG
Reverse primer:GCAATCATGGACACACAAGCOvergo seq rv: CGCTATGCTGCCGGAACGAAAGAC
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5165Mimulus unigene:MlU1203Phytome id:
 Arabidopsis homolog:At5g03300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCGTTGGTATCGACAAGCOvergo seq fw:
Reverse primer:TTTCTCGACAAACCTTTCTGCOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5166Mimulus unigene:MlU1205Phytome id:
 Arabidopsis homolog:At1g76160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCACTACCGGTTTTCTCCOvergo seq fw:
Reverse primer:CAAAAACGATCTCGATGAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5167Mimulus unigene:MlU1206Phytome id:
 Arabidopsis homolog:At5g54770
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGAATTTCAGCTTCATCAGCOvergo seq fw:TGCCTTCTGACCCGATATCATCAT
Reverse primer:GAGCAACGGGAGTTAAGAGGOvergo seq rv: ACCGACGTTTGGAGCTATGATGAT
Tm:59.1Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5168Mimulus unigene:MlU1211Phytome id:
 Arabidopsis homolog:At5g49460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTGCTTGGTGAACATTCCOvergo seq fw:
Reverse primer:GTGGGGCTATTGATGATGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5169Mimulus unigene:MlU1212Phytome id:
 Arabidopsis homolog:At1g78900
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGGATCCTCGAATTTCTGCOvergo seq fw:GCCACCAATGTTTCCTCTCCTTCT
Reverse primer:GGACTATCTTGCCCAGAATGCOvergo seq rv: AATTCGAGGATCCAGCAGAAGGAG
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5170Mimulus unigene:MlU1214Phytome id:
 Arabidopsis homolog:At2g34250
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)2+4 27.30cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGGATATGAACCCTGTTGCOvergo seq fw:CTCCTTCTGTAGGTTTGATTCTCT
Reverse primer:CAACTTGGAGTTGGGAATGCOvergo seq rv: GGTGATGCCTGGACACAGAGAATC
Tm:60.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5171Mimulus unigene:MlU1217Phytome id:
 Arabidopsis homolog:At2g28520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAATGCGGCAAAGGAAAAGGOvergo seq fw:
Reverse primer:TTTGTGCATCAAATGATACATGCOvergo seq rv:
Tm:62.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5172Mimulus unigene:MlU1218Phytome id:
 Arabidopsis homolog:At2g05830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGTGACCACAGACACTGGOvergo seq fw:
Reverse primer:CACTGGTTGCTTGTCACTGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5173Mimulus unigene:MlU1222Phytome id:
 Arabidopsis homolog:At3g59920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTCCTCAGCAGCACTCGOvergo seq fw:
Reverse primer:CACAATGTTGCTCCCAAAGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5174Mimulus unigene:MlU1227Phytome id:
 Arabidopsis homolog:At1g73990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGCATCAACACTTTCACTGCOvergo seq fw:
Reverse primer:GCACAGAGTGCATATAGAAGTTTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5175Mimulus unigene:MlU1235Phytome id:
 Arabidopsis homolog:At4g02060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTACATTGAGCACCGATTGCOvergo seq fw:
Reverse primer:CTGGGACACATCAACAATGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):