Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (800 - 899) out of 1979 markers

MgSTS829Mimulus unigene:MgU5394Phytome id:mgut2180
 Arabidopsis homolog:At5g66470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 140.54cM
M. guttatus IM62_x_DUN RILs(2009)8 112.13cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 127.50cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATCAAACCAGGTGAAATCGOvergo seq fw:CCGACTGTGTAGTCATTGTCGTTG
Reverse primer:TAATAAGCGGGTCCATGAGGOvergo seq rv: GGTGGTCTACAAGCATCAACGACA
Tm:59.0Tm:65.40
IM62 length0BAC contig(s):MgFPC770, MgFPC995
    
MgSTS830Mimulus unigene:MgU5402Phytome id:mgut2185
 Arabidopsis homolog:At2g34770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAATTGTCAGCAAGGAAGGOvergo seq fw:
Reverse primer:AATGTCCAGGCGAAAATGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MgSTS831Mimulus unigene:MgU5426Phytome id:
 Arabidopsis homolog:At4g38890
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 2.83cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTAATGGCTTCGGAATTTGCOvergo seq fw:
Reverse primer:TGCTTTATCGTATGCGTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MgSTS832Mimulus unigene:MgU5442Phytome id:mgut2199
 Arabidopsis homolog:At1g16570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 69.01cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:TTGCATACTTCGTCGTCAGGOvergo seq fw:CTGTTTGCATACTTCGTCGTCAGG
Reverse primer:GAAACAGCACAGACAGGTAATCCOvergo seq rv: CATGGGAAGATCCAACCCTGACGA
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS833Mimulus unigene:MgU5462Phytome id:mgut2203
 Arabidopsis homolog:At5g57440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATTAAAGTCCACAAGAGAGCOvergo seq fw:
Reverse primer:GCCATCTGGCGTCCTAGCOvergo seq rv:
Tm:57.1Tm:
IM62 length0BAC contig(s):
    
MgSTS834Mimulus unigene:MgU5514Phytome id:mgut2222
 Arabidopsis homolog:At1g10840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 137.59cM
M. guttatus IM62_x_DUN RILs(2009)14 18.58cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 15.90cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTACTGGGCAGCTTCTTGGOvergo seq fw:
Reverse primer:TAGCACCTTCCGCTTCAACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS835Mimulus unigene:MgU5527Phytome id:mgut2226
 Arabidopsis homolog:At4g17170
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 76.88cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAAAAACTGCACAGAATGTCGOvergo seq fw:CTTTCCCACAGAAGGGCTGTTAGC
Reverse primer:ACCCTGAATTCCACCGTACCOvergo seq rv: GTTCTCCTTCTTCTGTGCTAACAG
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):MlFPC333, MlFPC671
    
MgSTS836Mimulus unigene:MgU5551Phytome id:mgut2236
 Arabidopsis homolog:At5g58720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 114.78cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 36.22cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGTTCTCTTCGGAATACGCOvergo seq fw:
Reverse primer:AGGGCTATCACTGGATGTGGOvergo seq rv:
Tm:57.6Tm:
IM62 length0BAC contig(s):
    
MgSTS837Mimulus unigene:MgU5601Phytome id:mgut2259
 Arabidopsis homolog:At5g01750
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 105.03cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGACGCACGATCTCTCGOvergo seq fw:
Reverse primer:GGAACCCCTATCATCACTTTCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MgSTS838Mimulus unigene:MgU5625Phytome id:mgut2264
 Arabidopsis homolog:At4g29430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTCAGCTGCTGGGTAGGOvergo seq fw:
Reverse primer:TCCTCGTGATCCAACACTCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MgSTS839Mimulus unigene:MgU5684Phytome id:mgut2291
 Arabidopsis homolog:At3g29100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGCTTGAGTCTGGAATGGOvergo seq fw:
Reverse primer:CTCAAGCATGACCTTTCTGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MgSTS840Mimulus unigene:MgU5696Phytome id:mgut2294
 Arabidopsis homolog:At2g41620
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 62.88cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAACAAGCTGCTCCTTCAGCOvergo seq fw:
Reverse primer:CCGCAATAGATTGGGAAGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS841Mimulus unigene:MgU5716Phytome id:mgut2303
 Arabidopsis homolog:At3g04680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:TTGCTTTCAAAGTTGATGTCGOvergo seq fw:
Reverse primer:GCATCTAGTTTTAGCCGTCTCGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MgSTS842Mimulus unigene:MgU5730Phytome id:mgut2312
 Arabidopsis homolog:At3g12760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 90.85cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGAATAAGCTGGGCAGAGGOvergo seq fw:
Reverse primer:TCTAGGTGCCTTGTGTCAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS843Mimulus unigene:MgU5732Phytome id:mgut2314
 Arabidopsis homolog:At5g19690
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 32.54cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CTGTGGATGGTTCGGATAGGOvergo seq fw:
Reverse primer:AGGCTGTTAAGCATGGTTGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS844Mimulus unigene:MgU5733Phytome id:mgut2315
 Arabidopsis homolog:At1g08490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACATTCATCCAACAGATATTGCOvergo seq fw:
Reverse primer:CTGAGCGCAATGATGACCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MgSTS845Mimulus unigene:MgU5738Phytome id:mgut2317
 Arabidopsis homolog:At2g20725
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGCTGCTTCGTATTTTGCOvergo seq fw:
Reverse primer:CAGAAACGGAGTCACAAAGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MgSTS846Mimulus unigene:MgU5739Phytome id:mgut2318
 Arabidopsis homolog:At2g24490
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 27.42cM
M. guttatus IM62_x_DUN RILs(2009)10 73.59cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATCGCAACACACTTTCTCGOvergo seq fw:CTTCTCTTCTCAAAACGCCGATTC
Reverse primer:AAGGGACGGTTTGATGTCCOvergo seq rv: AGCAGATGTGCGGGAAGAATCGGC
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS847Mimulus unigene:MgU5748Phytome id:mgut2325
 Arabidopsis homolog:At1g04420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 6.85cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AATGCTGCTAAAGTCGAAGGOvergo seq fw:GGGAAAGCGTGTCATTCGTTGAGC
Reverse primer:CCAATGTTGCAGTTGTTTGGOvergo seq rv: TGAAATCCTCTCAGCTGCTCAACG
Tm:57.3Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS848Mimulus unigene:MgU5750Phytome id:mgut2327
 Arabidopsis homolog:At4g21520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTCGATATCTTGGAACTGGOvergo seq fw:
Reverse primer:GCAGCTTGAAAGCTTGATACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS849Mimulus unigene:MgU5771Phytome id:mgut2334
 Arabidopsis homolog:At4g34840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 59.62cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCATCAGATGTTGCTTTCCOvergo seq fw:CTAGTGGATAAGTTTCAGCTCGCC
Reverse primer:CTTGACGTGAGCCAACACCOvergo seq rv: CAGAATCAGGATCCTCGGCGAGCT
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS850Mimulus unigene:MgU5778Phytome id:mgut2337
 Arabidopsis homolog:At5g03900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTTGGTGATTGGTCTTGGOvergo seq fw:
Reverse primer:CCGACACGAATGATATGAACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MgSTS851Mimulus unigene:MgU5782Phytome id:mgut2338
 Arabidopsis homolog:At2g42810
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)13 27.34cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 23.38cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:AATCGATCGGTTTTGTGAGCOvergo seq fw:CGACAGGGGTTCTTTCTCTGTAGA
Reverse primer:GCCAAAAGAAAGACCAACACCOvergo seq rv: CAGTGTGAGTATCACCTCTACAGA
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS852Mimulus unigene:MgU5831Phytome id:mgut2355
 Arabidopsis homolog:At5g39590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 143.17cM

Set:D2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTTCTCAGGCGAATCTTCCOvergo seq fw:GCGCCTAACGGCACCTGGATTAAA
Reverse primer:TGGAGGTATGGGGATTAGGGOvergo seq rv: GATGATGGATATGATGTTTAATCC
Tm:59.5Tm:64.38
IM62 length0BAC contig(s):MgFPC284, MgFPC314, MgFPC339
    
MgSTS853Mimulus unigene:MgU5845Phytome id:mgut2362
 Arabidopsis homolog:At5g02100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGGTGCTCTGTGTATTTCCOvergo seq fw:
Reverse primer:AGATGGGCACTTGAGAAAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS854Mimulus unigene:MgU5880Phytome id:mgut2376
 Arabidopsis homolog:At1g23460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATCCGAAGACCATTTGTGGOvergo seq fw:
Reverse primer:TGCATCTCGATTGTGAATGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS855Mimulus unigene:MgU5885Phytome id:mgut2378
 Arabidopsis homolog:At5g50430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 78.18cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTAAAGCGCCTCCAAAAGGOvergo seq fw:
Reverse primer:CCACCACATTGGAGACAGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MgSTS856Mimulus unigene:MgU5909Phytome id:
 Arabidopsis homolog:At1g53230
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:gcagatgaaacacaacgccgOvergo seq fw:CGAAGTCGAAGGCCGCCATTAAAG
Reverse primer:tctctagccctagctctggcOvergo seq rv: TTCATCTGCACGAGGTCTTTAATG
Tm:Tm:66.43
IM62 length0BAC contig(s):
    
MgSTS857Mimulus unigene:MgU5910Phytome id:
 Arabidopsis homolog:At5g61850
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:acggagccgggggaggtgOvergo seq fw:CCGCGAGTTCTTGATCCAAGTTCA
Reverse primer:ctcattttgtatatttaaaaatagatOvergo seq rv: CTCCTTGGCAATGTTCTGAACTTG
Tm:Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS858Mimulus unigene:MgU5911Phytome id:
 Arabidopsis homolog:At1g53230
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:cttcgaccgaaggggttgtcOvergo seq fw:CCCTCGATTGGCTCCTCACCAAAT
Reverse primer:attctgcagaactcgagctgOvergo seq rv: TTGATGGAGGATTTGGATTTGGTG
Tm:Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS859Mimulus unigene:MgU5912Phytome id:
 Arabidopsis homolog:At3g54340
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:aaagagaatagagaaccaaacaaOvergo seq fw:CAGTACTCAGAAACTCCATGAACA
Reverse primer:gatattgatcaaacatctgttttOvergo seq rv: GATGGAGGGGCTGATGTGTTCATG
Tm:Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5000Mimulus unigene:MlU10Phytome id:
 Arabidopsis homolog:At3g62600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAATACAGGATGTTTTGCTTGCOvergo seq fw:
Reverse primer:ATTAGGACCTGGTCGCTTCCOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5001Mimulus unigene:MlU13Phytome id:
 Arabidopsis homolog:At3g55800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCTTGGCTTTAGCAGTTGGOvergo seq fw:
Reverse primer:TCACGAGTTCCTCCTTCTCGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5002Mimulus unigene:MlU16Phytome id:
 Arabidopsis homolog:At5g27970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACATGTTGTTTGCCTCTCGOvergo seq fw:
Reverse primer:CATTCTCATCTGTCAAGAATTTTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5003Mimulus unigene:MlU25Phytome id:
 Arabidopsis homolog:At1g78900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGAGTGGCTGATGTGACGOvergo seq fw:
Reverse primer:CCTGTAGCTGCTCGTGAGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5004Mimulus unigene:MlU35Phytome id:
 Arabidopsis homolog:At3g04120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACCACTAACTGCCTTGCOvergo seq fw:
Reverse primer:CATAAGTGGCAGCCTTCTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5005Mimulus unigene:MlU43Phytome id:
 Arabidopsis homolog:At3g05290
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACTGATTGCACCAAAAACCOvergo seq fw:CGTTATCTTCGTCTGAATCTGCTG
Reverse primer:CACAGCAAATCCTTCCATCCOvergo seq rv: GTGATGATCCAATCAGCAGCAGAT
Tm:59.0Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5006Mimulus unigene:MlU46Phytome id:
 Arabidopsis homolog:At2g27600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTATTCGTGCCAAATGTGCOvergo seq fw:
Reverse primer:TCTGTAGCAACGGCTTTCGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5008Mimulus unigene:MlU59Phytome id:
 Arabidopsis homolog:At5g45560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTATGAGTATCACGGCGAAGGOvergo seq fw:
Reverse primer:TTCTCCCAAACTGATGAAAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5009Mimulus unigene:MlU62Phytome id:
 Arabidopsis homolog:At1g79530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGAGTCACCAACAAAGTCGOvergo seq fw:
Reverse primer:ACACAGAAGGCGGTAGATGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5010Mimulus unigene:MlU67Phytome id:
 Arabidopsis homolog:At5g63960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTGTGTTCAATCATTTGTCGOvergo seq fw:
Reverse primer:TTTTGGCAGCTCGTAAAAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5011Mimulus unigene:MlU68Phytome id:
 Arabidopsis homolog:At2g36200
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTGCCTTGAAAAGAATCGOvergo seq fw:
Reverse primer:GCATGAGGGAGTGTAATGAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5012Mimulus unigene:MlU73Phytome id:
 Arabidopsis homolog:At1g75330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTGGCCCATACTGATCCOvergo seq fw:
Reverse primer:GGAACATTTTGGTGGACTGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5013Mimulus unigene:MlU75Phytome id:
 Arabidopsis homolog:At4g38470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTCCTTCTCCATCATCTCCOvergo seq fw:
Reverse primer:GTTTTGGGGTGGTTTTATGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5014Mimulus unigene:MlU79Phytome id:
 Arabidopsis homolog:At3g05590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 48.60cM

Set:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCAGAGCAAGCTGATCGOvergo seq fw:CTCATTGAAGCTGCTTCCGGTCCT
Reverse primer:CTGTTTAGGAGGACCGGAAGCOvergo seq rv: CCGATTTCTGTTTAGGAGGACCGG
Tm:59.8Tm:65.4
IM62 length0BAC contig(s):MlFPC1421, MlFPC294, MlFPC416, MlFPC731
    
MlSTS5015Mimulus unigene:MlU104Phytome id:
 Arabidopsis homolog:At4g34350
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCATACTTTTGCATCATGGOvergo seq fw:ATAGGACCCTCTGGTAGCCAGTTC
Reverse primer:GTGGCTACTGCCTCTTTTGCOvergo seq rv: AGTTGGTGGAGAAAGAGAACTGGC
Tm:58.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5016Mimulus unigene:MlU115Phytome id:
 Arabidopsis homolog:At1g76550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACACCTTGTCTGAGCAAACCOvergo seq fw:
Reverse primer:TGCACTCTCCAGTCTCATCCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5017Mimulus unigene:MlU128Phytome id:
 Arabidopsis homolog:At2g42710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTTTGCTTGCCATTAGCCOvergo seq fw:
Reverse primer:AGAGCAGCATGAGGAAGAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5018Mimulus unigene:MlU134Phytome id:
 Arabidopsis homolog:At5g17710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGTCTTCGCGCATTATGGOvergo seq fw:
Reverse primer:GGGGAAACCATTCGATCCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5019Mimulus unigene:MlU143Phytome id:
 Arabidopsis homolog:At1g09640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCTAAGCCCGTTGAAGCOvergo seq fw:
Reverse primer:TCGTCCATCACAAACTGAGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5020Mimulus unigene:MlU145Phytome id:
 Arabidopsis homolog:At3g63410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGTTTCACACCAGTGACGOvergo seq fw:
Reverse primer:GCCACATCAGCTTGAAAAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5021Mimulus unigene:MlU148Phytome id:
 Arabidopsis homolog:At1g29800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACCAATAAGAATTTCCGATGCOvergo seq fw:
Reverse primer:CAAACGAAGCAGTGAAAACGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5022Mimulus unigene:MlU153Phytome id:
 Arabidopsis homolog:At5g26850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAGATCTTGGGTATGAAACGOvergo seq fw:
Reverse primer:AGAAGCTTTGGCAACTCTCGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5023Mimulus unigene:MlU160Phytome id:
 Arabidopsis homolog:At1g29630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGGCAAACGAAGTGAAGCOvergo seq fw:
Reverse primer:TCAATCATGATGCCATTTCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5024Mimulus unigene:MlU168Phytome id:
 Arabidopsis homolog:At1g67430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACGCCATCAGAAAGCTACCOvergo seq fw:
Reverse primer:TGACGGATTCTTCCTTTTCGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5026Mimulus unigene:MlU174Phytome id:
 Arabidopsis homolog:At2g29570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACATTGATTCTGAACATTTAGGOvergo seq fw:
Reverse primer:TGGAACATCTTGTGACATGGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5027Mimulus unigene:MlU190Phytome id:
 Arabidopsis homolog:At1g05350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCTGGCCAATATGAACAGGOvergo seq fw:
Reverse primer:CAACTCAGAACTAAGTCCACAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5028Mimulus unigene:MlU192Phytome id:
 Arabidopsis homolog:At1g74320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTTTACGCTCCTCCAAACCOvergo seq fw:
Reverse primer:GGCTTAATGATGCCAAACGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5029Mimulus unigene:MlU210Phytome id:
 Arabidopsis homolog:At2g30600
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAGTTCCGCATGAAAGCOvergo seq fw:GGCTTGCACATCGTCTCGTCATTC
Reverse primer:TTTTCCAGATTCACCGATCCOvergo seq rv: ACTTGAGAGTACACGAGAATGACG
Tm:60.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5030Mimulus unigene:MlU212Phytome id:
 Arabidopsis homolog:At5g12200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGGCATAGGAATGAAACGOvergo seq fw:
Reverse primer:TGGATCCATGTAGATTTGTGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5031Mimulus unigene:MlU219Phytome id:
 Arabidopsis homolog:At1g32060
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTTTCGACGTAAATGAGCOvergo seq fw:CCGGGGTAAGAGCAAGTCAATTTT
Reverse primer:GCAAACCCGATTTTGATGCOvergo seq rv: GGGTACCATGTGGAAGAAAATTGA
Tm:59.9Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5032Mimulus unigene:MlU224Phytome id:
 Arabidopsis homolog:At5g56750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAGCTAAACCAGCTATCCOvergo seq fw:
Reverse primer:TTGGCTCCAGTACCAACACCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5033Mimulus unigene:MlU229Phytome id:
 Arabidopsis homolog:At1g77120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACGGGATGAGTCTTGAACGOvergo seq fw:
Reverse primer:ATCAACTGTCGCCATTTTCGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5034Mimulus unigene:MlU233Phytome id:
 Arabidopsis homolog:At1g75060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCAGCCTTCACAAAACCOvergo seq fw:
Reverse primer:CGAGGCATCGTATGTACCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5035Mimulus unigene:MlU242Phytome id:
 Arabidopsis homolog:At3g16240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGGACTTTTCTACTGGATCGOvergo seq fw:
Reverse primer:CACTCCGTGAATTGGAATCGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5036Mimulus unigene:MlU252Phytome id:
 Arabidopsis homolog:At3g01280
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGCGTTTGTGAAACTTGCOvergo seq fw:CTGTGTGGTAATACGACGCACTCA
Reverse primer:CCGATTTTAAAGTGGATACGGOvergo seq rv: GACAAGGGTGATAGCTTGAGTGCG
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5037Mimulus unigene:MlU255Phytome id:
 Arabidopsis homolog:At3g25420
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGAACTGCAACGCTTCACGOvergo seq fw:
Reverse primer:CCTAACATCACGAGGCTATCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5038Mimulus unigene:MlU276Phytome id:
 Arabidopsis homolog:At2g29940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGAATTTTGACGGAGATGGOvergo seq fw:
Reverse primer:CACTCCCAATCAACACTTGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5039Mimulus unigene:MlU281Phytome id:
 Arabidopsis homolog:At3g57290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCGGCTTTTCATCTTCGOvergo seq fw:
Reverse primer:CAGAAAGTGCTTTGGTGTGGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5040Mimulus unigene:MlU282Phytome id:
 Arabidopsis homolog:At4g02900
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)7 16.70cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTTGGAGCTGTTGGAATGCOvergo seq fw:
Reverse primer:AGCCACGTGATGTTTACTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5041Mimulus unigene:MlU285Phytome id:
 Arabidopsis homolog:At4g36250
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAAGCCCAATAAATGAAGCOvergo seq fw:CTTCCGAAACCACTTTGACCTACT
Reverse primer:GGAAGCGTCACATTCAACGOvergo seq rv: CACTGCCATTTGGAGGAGTAGGTC
Tm:57.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5042Mimulus unigene:MlU296Phytome id:
 Arabidopsis homolog:At4g22670
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATAAATCGCGTGGCATAGCOvergo seq fw:TTCTCTCCGATCCCTCTCTCTCCT
Reverse primer:TCTTTTGCTTGATGATGACTGCOvergo seq rv: ATGTAGTCACGGAAGAAGGAGAGA
Tm:58.8Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5043Mimulus unigene:MlU297Phytome id:
 Arabidopsis homolog:At1g10200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTGTTTATCTCGTTGATCGOvergo seq fw:
Reverse primer:TTTTCGACCGTCTTTTCTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5044Mimulus unigene:MlU298Phytome id:
 Arabidopsis homolog:At2g20450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGCTCTTTTCCCATTTCCOvergo seq fw:
Reverse primer:GGTAGCCCTCGTCAACTACGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5045Mimulus unigene:MlU300Phytome id:
 Arabidopsis homolog:At4g00755
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATTCTCCCCTTTCATCGOvergo seq fw:GCTGGAGATAGTGGTCTGCCAACA
Reverse primer:ATTGGCCATCCAAAAGTCCOvergo seq rv: TCAACCATGTCCAAGTTGTTGGCA
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5046Mimulus unigene:MlU307Phytome id:
 Arabidopsis homolog:At3g10420
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCGATCCCCATTACAGCOvergo seq fw:CCCCATTACAGCTGCTACTTGCAG
Reverse primer:CCGACGAGTAGATGATGAAGCOvergo seq rv: CCAAGAAGCTGATTTGCTGCAAGT
Tm:60.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5047Mimulus unigene:MlU308Phytome id:
 Arabidopsis homolog:At3g63520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCTCGCCGGTAACTTTGCOvergo seq fw:
Reverse primer:CACAAAGCGTGAGACAAAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5048Mimulus unigene:MlU317Phytome id:
 Arabidopsis homolog:At1g12360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGTCTTTTGGCAATTCTCCOvergo seq fw:
Reverse primer:GAGGGTGACAAAGCAATTAAGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5049Mimulus unigene:MlU324Phytome id:
 Arabidopsis homolog:At3g54110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 0.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTCCAGAATAGCGTCTAGGOvergo seq fw:
Reverse primer:GGATTGTTGGGAACAGTTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5050Mimulus unigene:MlU329Phytome id:
 Arabidopsis homolog:At2g22430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTCTCTTCGTCGGAAACGOvergo seq fw:
Reverse primer:GACAATGTTGGAGGGTTTGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5051Mimulus unigene:MlU349Phytome id:
 Arabidopsis homolog:At1g77350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAAACTCGATGAACAGTGCOvergo seq fw:
Reverse primer:CATTGGTAATTATCAGGAAACATGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5052Mimulus unigene:MlU359Phytome id:
 Arabidopsis homolog:At2g36530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACTATCAAGAGCGTCAAGGOvergo seq fw:
Reverse primer:TCGAGAGCCTCGTAAACACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5053Mimulus unigene:MlU372Phytome id:
 Arabidopsis homolog:At1g15690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACCGCCAAACCAGATTACGOvergo seq fw:
Reverse primer:CCCGAAGTATCCTTGAGTGGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5054Mimulus unigene:MlU393Phytome id:
 Arabidopsis homolog:At1g47830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTAGATAACCTTGTGCGTTCGOvergo seq fw:
Reverse primer:GAATAGGCAAGGAAAAACTCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5056Mimulus unigene:MlU401Phytome id:
 Arabidopsis homolog:At3g10410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGACGATCTTCGTTTTACCGOvergo seq fw:
Reverse primer:GTCCCAGCCATACTCATTCCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5057Mimulus unigene:MlU412Phytome id:
 Arabidopsis homolog:At2g47240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAAAAACTCGAGGCACTCCOvergo seq fw:
Reverse primer:AGGGGTCGATCTTTTCATGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5059Mimulus unigene:MlU418Phytome id:
 Arabidopsis homolog:At1g65650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACAACATCAAGCCAATCAGCOvergo seq fw:
Reverse primer:TGGGTACCAGAGACAGAACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5060Mimulus unigene:MlU438Phytome id:
 Arabidopsis homolog:At2g43040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCCAAAGCTTCACTAATGCOvergo seq fw:
Reverse primer:GCTCAGGATGAAAGCAAAGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5061Mimulus unigene:MlU450Phytome id:
 Arabidopsis homolog:At1g36240
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAAGCATGGCATAGTACTCGOvergo seq fw:TCGGAAATACTTCCCGCAGGCTGT
Reverse primer:TGCTCTTGTGATGAAGAGTGGOvergo seq rv: CAATGTTGATCTGGGAACAGCCTG
Tm:60.8Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5062Mimulus unigene:MlU460Phytome id:
 Arabidopsis homolog:At5g20920
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)7 14.80cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACTTGTTCCCATTTCAGCOvergo seq fw:GGTTCTCCTTTGAGAGGATGGTAT
Reverse primer:TACCGTTGGAGAGGATGAGGOvergo seq rv: GGCTGCAAAAGTCCAGATACCATC
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):MgFPC1135, MgFPC1156, MgFPC681, MgFPC721, MlFPC1267, MlFPC699
    
MlSTS5063Mimulus unigene:MlU464Phytome id:
 Arabidopsis homolog:At4g32360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGATTCCGCCAAGACACGOvergo seq fw:
Reverse primer:GTGTTCGGCTTGAGAAGACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5064Mimulus unigene:MlU465Phytome id:
 Arabidopsis homolog:At1g69210
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGGATTTCTCCCCTTGCOvergo seq fw:
Reverse primer:GTCGAACCGATTGATTTATGGOvergo seq rv:
Tm:61.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5065Mimulus unigene:MlU472Phytome id:
 Arabidopsis homolog:At1g50480
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGCTCATGGTGGGAAAGGOvergo seq fw:GTGCAGCGTTGTCTGCGGGAGCTT
Reverse primer:CTTATCGGCAGGACAAAACCOvergo seq rv: CAAATAACAGCATCAAAAGCTCCC
Tm:60.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5066Mimulus unigene:MlU473Phytome id:
 Arabidopsis homolog:At4g13930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACTGGTGGAACTGAAAACCOvergo seq fw:
Reverse primer:TCGCTGTTGTTGACAAGTCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5067Mimulus unigene:MlU479Phytome id:
 Arabidopsis homolog:At5g56940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAATTAATCCCCATTCTTTTGCOvergo seq fw:
Reverse primer:ATTGAGGCTGTCGAGATTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5068Mimulus unigene:MlU488Phytome id:
 Arabidopsis homolog:At1g03630
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCAAGCCAATCCAACAAGCOvergo seq fw:ATCTATCATGGACGATGTGCCTAC
Reverse primer:GAGGATTGAACGGAGTAGGCOvergo seq rv: GGGAGGATTGAACGGAGTAGGCAC
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5069Mimulus unigene:MlU498Phytome id:
 Arabidopsis homolog:At1g10840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACCCTTGAGAGGTTTTCAGGOvergo seq fw:
Reverse primer:ATTGACCATCTCCATGTTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5070Mimulus unigene:MlU506Phytome id:
 Arabidopsis homolog:At5g15240
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACGAGAGCCACAATGATCGOvergo seq fw:CGCCATCGATGCATATCCCATTGT
Reverse primer:GTGAGAAGGGCAGAGTTTCGOvergo seq rv: TTGCTTTCTCGTGTGCACAATGGG
Tm:59.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5071Mimulus unigene:MlU513Phytome id:
 Arabidopsis homolog:At1g33140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGACGAATTCATCCTTTTGCOvergo seq fw:
Reverse primer:AACCCTGTATCGCAACTTCCOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5072Mimulus unigene:MlU520Phytome id:
 Arabidopsis homolog:At4g00370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGCAGTTCCAAAAACACCOvergo seq fw:
Reverse primer:AGACACCTGCTTTAGCTGTGCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):