Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (700 - 799) out of 1979 markers

MgSTS729Mimulus unigene:MgU6127Phytome id:
 Arabidopsis homolog:At5g20290
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 4.99cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 113.42cM

Set:B / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTTGGCTTGTATTTCTTCTCGOvergo seq fw:CTATGGTGTTGATATCGGCAGGAA
Reverse primer:GTCTTGCCCTTCTTCTTTTGGOvergo seq rv: AGCTCCTCCCTTCTTCTTCCTGCC
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS730Mimulus unigene:MgU2430Phytome id:
 Arabidopsis homolog:At5g20160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTGGTCGAGCATGTGGOvergo seq fw:
Reverse primer:TGAGCTCTCAACTGGCTTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS731Mimulus unigene:MgU1288Phytome id:
 Arabidopsis homolog:At2g39460
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 78.26cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCGTAGTCGGGAGTCAACCOvergo seq fw:
Reverse primer:GCAACAAGCTTGACCATTACCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MgSTS732Mimulus unigene:MgU6130Phytome id:
 Arabidopsis homolog:At3g47470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATAGCTTGCCTCCCAACGOvergo seq fw:
Reverse primer:CCAAGAACGCCAACATCGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MgSTS733Mimulus unigene:MgU6126Phytome id:
 Arabidopsis homolog:At4g34670
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 156.84cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGGAAAGAGATTGAAAAGGOvergo seq fw:
Reverse primer:TCTCCACCTTCACACCAACCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MgSTS734Mimulus unigene:MgU4415Phytome id:
 Arabidopsis homolog:At1g08380
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 8.10cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTTCCATTTTGTCTTCTCCOvergo seq fw:
Reverse primer:TCCTCCTGAGGCTTGTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS735Mimulus unigene:MgU6004Phytome id:
 Arabidopsis homolog:At1g07890
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 32.98cM
M. guttatus IM62_x_DUN RILs(2009)14 120.30cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAAAGAAGGCATCCTCATCCOvergo seq fw:CAAGTGAGCCTCAGCATAGTCTGC
Reverse primer:GACCATGGACCGAAAACCOvergo seq rv: TGAGGATGCCTTCTTTGCAGACTA
Tm:59.6Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS736Mimulus unigene:MgU1641Phytome id:
 Arabidopsis homolog:At1g79040
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 91.29cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGAAAGGGTGTTTACCAGTACGOvergo seq fw:GGCCAGTGGCATCAAGAAGATCAA
Reverse primer:ACGTAAACATCACCGGTTGGOvergo seq rv: ATAAGGAGTGTCGGTCTTGATCTT
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):MgFPC43, MgFPC526, MgFPC533
    
MgSTS737Mimulus unigene:MgU420Phytome id:
 Arabidopsis homolog:At2g16850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACTCCCGATAGGGTTTGCOvergo seq fw:
Reverse primer:GATCCCAACGCCTTAATAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MgSTS738Mimulus unigene:MgU1415Phytome id:
 Arabidopsis homolog:At5g61790
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 61.35cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 48.62cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTACAAGGTTGCCGATCTCCOvergo seq fw:AAAGGAAGAGGAAACTACCGAGTC
Reverse primer:TTCCTTCTCCTCTGAGCTTCCOvergo seq rv: ACCCTTAAGCCCGTCAGACTCGGT
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):MlFPC1647, MlFPC89
    
MgSTS739Mimulus unigene:MgU4140Phytome id:
 Arabidopsis homolog:At3g09630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCGACAAGAAGAGGAAGCOvergo seq fw:
Reverse primer:TGCTTACTAGCAGACTGGATAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS740Mimulus unigene:MgU1844Phytome id:
 Arabidopsis homolog:At1g13440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGATGACCACTGTCCAAGCOvergo seq fw:
Reverse primer:ACATCAGCAGTTGGAACACGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS741Mimulus unigene:MgU1540Phytome id:
 Arabidopsis homolog:At3g16640
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)7 67.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 4.36cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTGCTGTCGGCTAAATTGGOvergo seq fw:TACAAGGAGATCGAGAACGGAGGT
Reverse primer:TCATCATGCATGCTCTCTCCOvergo seq rv: CATCGACTTCCCAAAGACCTCCGT
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):MlFPC1, MlFPC1507, MlFPC445, MlFPC69, MlFPC699, MlFPC789
    
MgSTS742Mimulus unigene:MgU6030Phytome id:
 Arabidopsis homolog:At3g52580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 97.26cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGAAGGTGAAGGCTGACAGGOvergo seq fw:CTGTGTCGCCCACATTTTTGCCTC
Reverse primer:GCGGCCAATCTTCATTCCOvergo seq rv: GAAGGTGTCGTTGAATGAGGCAAA
Tm:61.4Tm:65.40
IM62 length0BAC contig(s):MgFPC478, MgFPC528, MgFPC536, MgFPC971, MlFPC210, MlFPC386, MlFPC58
    
MgSTS743Mimulus unigene:MgU4085Phytome id:mgut1655
 Arabidopsis homolog:At1g53240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:polymorphic by sizePhys map status:
Forward primer:GCTGATGCTTGCTTGAAGGOvergo seq fw:
Reverse primer:TTCCTCCACACCATTCTTCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS744Mimulus unigene:MgU4424Phytome id:mgut1739
 Arabidopsis homolog:At1g09020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCAGCTTCAACAATAACAAGGOvergo seq fw:
Reverse primer:ACAGAGATGACCCGTTTTCGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS745Mimulus unigene:MgU4425Phytome id:mgut1740
 Arabidopsis homolog:At1g27510
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)9 10.71cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 69.40cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACTCGGGTAGTTCCAAACGOvergo seq fw:AACGTACAGAAAACCGAGGTCTGC
Reverse primer:GGAGCTTCTTCAACTCAACGOvergo seq rv: CCCGTATGTCAAAGGTGCAGACCT
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):MgFPC180, MgFPC2702
    
MgSTS746Mimulus unigene:MgU4455Phytome id:mgut1751
 Arabidopsis homolog:At3g16780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 68.72cM
M. guttatus IM62_x_DUN RILs(2009)7 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 60.69cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAGGAAGCCAAACGAAAGGOvergo seq fw:GATGAAGGAAGCCAAACGAAAGGG
Reverse primer:GACACGCATTCTCCTCATCCOvergo seq rv: GTATCCAGAGTGACGACCCTTTCG
Tm:61.1Tm:65.40
IM62 length0BAC contig(s):MgFPC2733, MgFPC2878
    
MgSTS747Mimulus unigene:MgU4462Phytome id:mgut1754
 Arabidopsis homolog:At1g12000
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 28.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 69.86cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCCGACAAATTGAATGGOvergo seq fw:CCCACTCTTCCCGCATGGATACAA
Reverse primer:AAAGAAGGCAATGGTTGAGCOvergo seq rv: GCCCCATTCAAGAAATTTGTATCC
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):MlFPC1084, MlFPC1336, MlFPC1435, MlFPC261
    
MgSTS748Mimulus unigene:MgU4477Phytome id:mgut1764
 Arabidopsis homolog:At3g52580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CCGTATGCTGCTATGCTTGCOvergo seq fw:
Reverse primer:CCAGGGGTCTTAGTCTTGTTACCOvergo seq rv:
Tm:61.8Tm:
IM62 length0BAC contig(s):
    
MgSTS749Mimulus unigene:MgU4491Phytome id:mgut1772
 Arabidopsis homolog:At1g29880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGGGATGAACAATTGAACGOvergo seq fw:
Reverse primer:AGGAACTCCGAGCTCATCGOvergo seq rv:
Tm:61.7Tm:
IM62 length0BAC contig(s):
    
MgSTS750Mimulus unigene:MgU4498Phytome id:mgut1776
 Arabidopsis homolog:At3g25520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 32.86cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCATCATCATCGGCATTACCOvergo seq fw:GCCTCCGTAGATGTACTTTCTATG
Reverse primer:CGATAAACAGCAGCCAAAGGOvergo seq rv: GCTTGACCCTGAAGTGCATAGAAA
Tm:59.3Tm:65.40
IM62 length0BAC contig(s):MgFPC215, MgFPC467, MlFPC1185, MlFPC167, MlFPC497
    
MgSTS751Mimulus unigene:MgU4502Phytome id:mgut1781
 Arabidopsis homolog:At4g31700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGAAGTCAATGGAGATGCOvergo seq fw:
Reverse primer:AAGACACCCTGCTTCATTGGOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MgSTS752Mimulus unigene:MgU4516Phytome id:mgut1792
 Arabidopsis homolog:At1g77940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTTGTGGTGAAGAGTGGOvergo seq fw:
Reverse primer:AATTTCCGACTTCCTCAAAGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS753Mimulus unigene:MgU4518Phytome id:mgut1794
 Arabidopsis homolog:At3g16500
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 62.61cM
M. guttatus IM62_x_DUN RILs(2009)9 67.96cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 28.70cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTATATTCCCCACTTCCATCCOvergo seq fw:CCAACAATCCTCCGATCCCTTTCC
Reverse primer:CTCTTCCGAGACCTTCTTGCOvergo seq rv: GACAGAGAAAATGGAGGGAAAGGG
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS754Mimulus unigene:MgU4521Phytome id:mgut1796
 Arabidopsis homolog:At3g54050
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 97.59cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATTTCATCTGGGCTTCCOvergo seq fw:
Reverse primer:GCAAGAATGGGAATTTGAGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MgSTS755Mimulus unigene:MgU4526Phytome id:mgut1800
 Arabidopsis homolog:At4g18100
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 3.71cM
M. guttatus IM62_x_DUN RILs(2009)4 126.48cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 112.79cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCGTGTGACAAAGTTCACGOvergo seq fw:CAAAGTTCACGAGGCACCAAAGCG
Reverse primer:ACGGGAATCAATACCCTTGGOvergo seq rv: ACAGAGACGAATCGATCGCTTTGG
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS756Mimulus unigene:MgU4533Phytome id:mgut1802
 Arabidopsis homolog:At1g67280
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 36.53cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGAGCTGACATACAATTACGGOvergo seq fw:GTGCCGTAATGGAGCTGACATACA
Reverse primer:GGTTCTCGGGTGATCTTTCCOvergo seq rv: TCCGTGACACCGTAATTGTATGTC
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):MgFPC645, MlFPC1, MlFPC413, MlFPC562
    
MgSTS757Mimulus unigene:MgU637Phytome id:mgut2576
 Arabidopsis homolog:At4g16760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 90.05cM
M. guttatus IM62_x_DUN RILs(2009)1 99.94cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 78.56cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCACAGCAGGGTTAAAGTCCOvergo seq fw:GATGACAGGCCGATGCTACCGAGG
Reverse primer:TTTCGACATTCTTCGATTCCOvergo seq rv: TTCTGAACAATTCCTTCCTCGGTA
Tm:59.7Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS758Mimulus unigene:MgU705Phytome id:
 Arabidopsis homolog:At4g24280
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 42.89cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCAACTGCTTCTCTGTCTGGOvergo seq fw:
Reverse primer:TAAGGGAACTGGGAAGAAGCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MgSTS759Mimulus unigene:MgU2215Phytome id:
 Arabidopsis homolog:At4g22310
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 27.45cM
M. guttatus IM62_x_DUN RILs(2009)13 65.56cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 71.22cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTCCTCCTCATTGAAGTAGTCGOvergo seq fw:TTCGCCACAACAGCCTTCTCCTCC
Reverse primer:TGGCTGGTACTGGAATTTACCOvergo seq rv: ACGACTACTTCAATGAGGAGGAGA
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):MgFPC37, MlFPC1108, MlFPC116, MlFPC584
    
MgSTS760Mimulus unigene:MgU2276Phytome id:
 Arabidopsis homolog:At1g26550
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 18.81cM
M. guttatus IM62_x_DUN RILs(2009)9 26.62cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTCCTTCAGACAAGATAATGTGGOvergo seq fw:ATCACCACCTTTCTTCCCCGACGG
Reverse primer:TGGTGATTTAGGATGGTTTCCOvergo seq rv: GGAATATTCGGAATGTCCGTCGGG
Tm:58.2Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS761Mimulus unigene:MgU2326Phytome id:
 Arabidopsis homolog:At3g60820
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 92.22cM
M. guttatus IM62_x_DUN RILs(2009)2 87.96cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 69.96cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTGTAGCCAGTGGACATTCGOvergo seq fw:CGACGAATTCCACTGGCATTCAGA
Reverse primer:TCTCCGTACGACAACAATGGOvergo seq rv: AGCTGGAGATTGTCGTTCTGAATG
Tm:59.3Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS762Mimulus unigene:MgU6087Phytome id:mgut2414
 Arabidopsis homolog:At1g70590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 18.32cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTCCGGACAGTGTAATTTAGCOvergo seq fw:GCTCGGCGATCCCTCCGGACAGTG
Reverse primer:CCATTCGAGTGCTTCTTTGGOvergo seq rv: TGAAATAGCTAAATTACACTGTCC
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS763Mimulus unigene:MgU3814Phytome id:mgut1531
 Arabidopsis homolog:At3g52390
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGAGCTGATCGATGTCTGCOvergo seq fw:
Reverse primer:GAAATACGATCCGGACTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS764Mimulus unigene:MgU3833Phytome id:mgut1540
 Arabidopsis homolog:At1g27970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 0.75cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCAATCTTCAGCTCTCTGGOvergo seq fw:TTTTGTTTCTGGCAATCTTCAGCT
Reverse primer:GCTGCCTTGAGGTGTTGGOvergo seq rv: GTGCTGCTCCCCAGAGAGCTGAAG
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS765Mimulus unigene:MgU3836Phytome id:mgut1541
 Arabidopsis homolog:At5g46180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCATACAGCCTGGAGAGCOvergo seq fw:
Reverse primer:CTCTCAGCCAGCCTCTCGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS766Mimulus unigene:MgU3853Phytome id:mgut1545
 Arabidopsis homolog:At1g62940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)11 84.77cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCTCATTGTCACCGATGGOvergo seq fw:
Reverse primer:CTGCCTCCAAAAGTTCATCCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MgSTS767Mimulus unigene:MgU3859Phytome id:mgut1546
 Arabidopsis homolog:At2g27020
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 59.90cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TATGGGGTGCATGATGAGGOvergo seq fw:GTCGCCAGTTATGTGCATCTGTGC
Reverse primer:TAGCTGCTGCCTTAGCTTCCOvergo seq rv: GCCACCAATATAGTGTGCACAGAT
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):MgFPC1262, MgFPC684, MlFPC109, MlFPC1678
    
MgSTS768Mimulus unigene:MgU3862Phytome id:mgut1548
 Arabidopsis homolog:At5g04740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGGCATTGGAACATCATCGOvergo seq fw:
Reverse primer:GTGTGTGCCTCTGTTGATGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS769Mimulus unigene:MgU3881Phytome id:mgut1561
 Arabidopsis homolog:At3g55530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 21.08cM

Set:
Guttatus map status:polymorphic by sizePhys map status:
Forward primer:GAAGGTTGCAAGGTCTTAGGCOvergo seq fw:
Reverse primer:GCTGCAGGAACATTGTCAGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS770Mimulus unigene:MgU3906Phytome id:mgut1572
 Arabidopsis homolog:At3g07760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGTTGGCCTGTGGTTGGOvergo seq fw:
Reverse primer:AGGCCTGCGTACCTTTTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MgSTS771Mimulus unigene:MgU3922Phytome id:mgut1580
 Arabidopsis homolog:At2g25740
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTCAGCAATTGACCATGCOvergo seq fw:GTACCAGCCCATTTGCATCCCACA
Reverse primer:GTCCGGTTAAGGAGTTCAGCOvergo seq rv: TGCTGAATGTATAGCGTGTGGGAT
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS772Mimulus unigene:MgU3941Phytome id:mgut1592
 Arabidopsis homolog:At3g27930
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 4.40cM

Set:
Guttatus map status:polymorphic by sizePhys map status:
Forward primer:TGAAGATTATGGCGTCATGGOvergo seq fw:
Reverse primer:TCCCATCTTGCTTACCAACCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS773Mimulus unigene:MgU4007Phytome id:mgut1619
 Arabidopsis homolog:At3g50830
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 1.18cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCGTACGAACTGGAAAACGOvergo seq fw:GCTCTTGATCCCGTACATTTTCCT
Reverse primer:AATCCACCTTCCAACTTCTCCOvergo seq rv: CCACGAGGGTAGAGTAAGGAAAAT
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS774Mimulus unigene:MgU4033Phytome id:mgut1631
 Arabidopsis homolog:At2g46700
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 107.25cM

Set:
Guttatus map status:polymorphic by sizePhys map status:
Forward primer:TGCCATTGGTCCTCAACCOvergo seq fw:
Reverse primer:AGCTTTTGACCATTTTGAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MgSTS775Mimulus unigene:MgU4060Phytome id:mgut1643
 Arabidopsis homolog:At5g64350
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 94.64cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGGAGCCTTTTTCTTTCCOvergo seq fw:
Reverse primer:GAGCAACTTCTCCCACTTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS776Mimulus unigene:MgU4064Phytome id:mgut1645
 Arabidopsis homolog:At3g18080
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)4 61.70cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 56.68cM

Set:
Guttatus map status:polymorphic by sizePhys map status:
Forward primer:GGGAGATTCCTCCACTGAGCOvergo seq fw:
Reverse primer:AACAGGATCCCGATTCTTCCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MgSTS777Mimulus unigene:MgU4075Phytome id:mgut1651
 Arabidopsis homolog:At3g22170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCGATAATTACTATGGGAACCOvergo seq fw:
Reverse primer:ATGTATGGCTGGTTGAGTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS778Mimulus unigene:MgU4101Phytome id:mgut1664
 Arabidopsis homolog:At5g55590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 14.98cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTCTATCAGCTCCTCTGCOvergo seq fw:
Reverse primer:TTCGACGTCAATGTCAGACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS779Mimulus unigene:MgU4104Phytome id:mgut1666
 Arabidopsis homolog:At1g68850
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 54.66cM

Set:
Guttatus map status:polymorphic by sizePhys map status:
Forward primer:TTTCCACGATTGCTTTGTCCOvergo seq fw:
Reverse primer:AAAACCGACCCATCACACCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MgSTS780Mimulus unigene:MgU4560Phytome id:mgut1817
 Arabidopsis homolog:At5g19460
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 38.86cM
M. guttatus IM62_x_DUN RILs(2009)11 50.07cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 33.45cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGGGAGAATCTTGTGAAGGOvergo seq fw:CACAGCAGTTGGAGCTGTATCTTA
Reverse primer:CAGTCTATAGCCGTTGATGTCCOvergo seq rv: GCCGTTGATGTCCATGTAAGATAC
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):MgFPC314, MlFPC558
    
MgSTS781Mimulus unigene:MgU4563Phytome id:mgut1819
 Arabidopsis homolog:At4g31130
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 33.72cM
M. guttatus IM62_x_DUN RILs(2009)1 22.78cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCAAATATCCGTCCGATCCOvergo seq fw:CCACAGACGGCTTTGTTCAAAAAC
Reverse primer:CGCTGCTAATCCAGTTGTACCOvergo seq rv: AGACGAAGAAGCCCGTGTTTTTGA
Tm:60.2Tm:65.40
IM62 length0BAC contig(s):MlFPC1, MlFPC1056
    
MgSTS782Mimulus unigene:MgU4603Phytome id:mgut1834
 Arabidopsis homolog:At4g34540
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)2 1.77cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTGATCTCCCTTCACAAACGOvergo seq fw:CAGCTCTGTTCCTTCCACACCATT
Reverse primer:GAAAATCGGGAAAAATCTCGOvergo seq rv: CGACATAAACTCGTCGAATGGTGT
Tm:60.2Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS783Mimulus unigene:MgU4618Phytome id:mgut1841
 Arabidopsis homolog:At1g19850
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 145.79cM

Set:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCCCATCTGCTTCACTTCCOvergo seq fw:CGACGGCGATAATATTCTTATGCA
Reverse primer:AAGTTGGTGTATGTGGATTTCGOvergo seq rv: TGTGGGGTGCGTGAGATGCATAAG
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS784Mimulus unigene:MgU4640Phytome id:mgut1853
 Arabidopsis homolog:At1g23190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 72.03cM
M. guttatus IM62_x_DUN RILs(2009)5 41.21cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 38.09cM

Set:C / D2
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:AAGATCCTGTTGACGGTTCCOvergo seq fw:GGCCTATCTGGTCAAGCTGGAATC
Reverse primer:GACCCAGTTCCAGAAAGACGOvergo seq rv: AACTTCAGAAAGGGAGGATTCCAG
Tm:59.0Tm:65.40
IM62 length0BAC contig(s):MlFPC778, MlFPC847
    
MgSTS785Mimulus unigene:MgU4656Phytome id:mgut1862
 Arabidopsis homolog:At1g23890
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 76.38cM

Set:D2
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CCGTCATCTTCCTTATGTTCGOvergo seq fw:ACGTCAAAGTCAACCCTCACTCTA
Reverse primer:GAGTGAGGGTTGACTTTGACGOvergo seq rv: GGAGATTGGTGGAGGATAGAGTGA
Tm:59.6Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS786Mimulus unigene:MgU4666Phytome id:mgut1869
 Arabidopsis homolog:At4g21580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGCTTTGTTTTCTGGTTGCOvergo seq fw:
Reverse primer:AAGAAACCGGAGGGAAAGGOvergo seq rv:
Tm:57.6Tm:
IM62 length0BAC contig(s):
    
MgSTS787Mimulus unigene:MgU4674Phytome id:mgut1873
 Arabidopsis homolog:At4g34350
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 7.66cM
M. guttatus IM62_x_DUN RILs(2009)4 105.32cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 0.00cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCATGATGCAAAAGTACGGOvergo seq fw:GCGGTGGACTTGATGGATCCAGCT
Reverse primer:CTGTCGACCCAATAAGATGGOvergo seq rv: AATGCCTCTTTAGTTGAGCTGGAT
Tm:60.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS788Mimulus unigene:MgU4678Phytome id:mgut1875
 Arabidopsis homolog:At1g56500
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 34.44cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACAAAGGCCTCAAAGTGGOvergo seq fw:
Reverse primer:GCATCCGCAGATACAATAGCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MgSTS789Mimulus unigene:MgU4709Phytome id:mgut1885
 Arabidopsis homolog:At3g12680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTTGCCGCTACAATCATCCOvergo seq fw:
Reverse primer:TGAGAGGAGAGATGCTGTCGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS790Mimulus unigene:MgU4711Phytome id:mgut1886
 Arabidopsis homolog:At2g07340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGCTGCTATTTCCTCTTTGCOvergo seq fw:
Reverse primer:ACAAGGCCATGATCTGACGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS791Mimulus unigene:MgU4740Phytome id:mgut1896
 Arabidopsis homolog:At5g27730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTGCATCATCTGAGGTTCGOvergo seq fw:
Reverse primer:GAATGCCCAGAATCACACGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MgSTS792Mimulus unigene:MgU4741Phytome id:mgut1897
 Arabidopsis homolog:At4g26470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCGAAAATTGACGAGAGCOvergo seq fw:
Reverse primer:TGAAACTGATCTCCAGCTTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS793Mimulus unigene:MgU4776Phytome id:mgut1910
 Arabidopsis homolog:At4g01940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTAATGGCTGGTCTTAAAATATCCOvergo seq fw:
Reverse primer:TGAAACTGGGAATTGAAAAGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MgSTS794Mimulus unigene:MgU4778Phytome id:mgut1911
 Arabidopsis homolog:At5g62670
Genetic markerPhysical marker
Map:Not MappedSet:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGACTTTCCGCCTTTTATGGOvergo seq fw:GTGCTTCGGATATTGTACTTACGG
Reverse primer:TGTCAGGCAGTGGAGAAGGOvergo seq rv: ACACTAAGGCCAGGCTCCGTAAGT
Tm:61.8Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS795Mimulus unigene:MgU4784Phytome id:mgut1916
 Arabidopsis homolog:At1g80620
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 47.95cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 36.85cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCTGTAAGAATCCCAATCGOvergo seq fw:CTTCTCTGAACCATTAGCTGAAGG
Reverse primer:GCTGACGACAAAGATCAAGCOvergo seq rv: AACATTCTCGGAGGGGCCTTCAGC
Tm:59.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS796Mimulus unigene:MgU4799Phytome id:mgut1927
 Arabidopsis homolog:At2g39690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCCGGAGAAAGTACAAGCOvergo seq fw:
Reverse primer:TGCGCCTTATAAGCATCTCCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MgSTS797Mimulus unigene:MgU4833Phytome id:mgut1946
 Arabidopsis homolog:At5g17900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTTGCCCGAAAAGGATCGOvergo seq fw:
Reverse primer:CACGACCGATTGGAATAACCOvergo seq rv:
Tm:62.9Tm:
IM62 length0BAC contig(s):
    
MgSTS798Mimulus unigene:MgU4842Phytome id:mgut1949
 Arabidopsis homolog:At3g44110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 46.92cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTTGCGGTGATTGTAGAGGOvergo seq fw:TTGACAAGGGCATGCAGAACGGCC
Reverse primer:GGATGTTCCTTCTGCTGAACCOvergo seq rv: GGGAATGTAATCTTCTGGCCGTTC
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS799Mimulus unigene:MgU4938Phytome id:mgut1988
 Arabidopsis homolog:At1g50940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGAAGCCAGCCTCAGCOvergo seq fw:
Reverse primer:GCGTTCGGTATCTTGAGAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MgSTS800Mimulus unigene:MgU4948Phytome id:mgut1995
 Arabidopsis homolog:At4g27720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 39.87cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCCTCCGCATTTTTCTCCOvergo seq fw:
Reverse primer:TGTTCCATCTTCCTCTTTACGGOvergo seq rv:
Tm:61.8Tm:
IM62 length0BAC contig(s):
    
MgSTS801Mimulus unigene:MgU4969Phytome id:mgut2007
 Arabidopsis homolog:At3g56310
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 37.78cM
M. guttatus IM62_x_DUN RILs(2009)6 28.58cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 72.14cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACTCGAGCCCAAGTGAAGCOvergo seq fw:TTCCATAAAACAACAGCCAAACGT
Reverse primer:CACTTGGAATTCAAGGAAGGOvergo seq rv: GCCCGCTTTCTGGGCAACGTTTGG
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS802Mimulus unigene:MgU4986Phytome id:mgut2014
 Arabidopsis homolog:At1g22850
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 0.90cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTGCTCCCTTTTTCCATCGOvergo seq fw:
Reverse primer:CTGGAAGCATGCACAACCOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MgSTS803Mimulus unigene:MgU5016Phytome id:mgut2028
 Arabidopsis homolog:At1g50900
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 8.02cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACTGGATGAATGTTCTGGOvergo seq fw:
Reverse primer:GTGCCGGTATTTATGGAAGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MgSTS804Mimulus unigene:MgU5018Phytome id:mgut2030
 Arabidopsis homolog:At1g51160
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 38.46cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCACAGCAAGATCACAAGCOvergo seq fw:CCCCTCAAAACCCTCAGTCCACAG
Reverse primer:TTAATCCCAGATGGACTCTCCOvergo seq rv: TTAGCTTGTGATCTTGCTGTGGAC
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):MlFPC42, MlFPC564
    
MgSTS805Mimulus unigene:MgU5021Phytome id:mgut2031
 Arabidopsis homolog:At4g17530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)1 74.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 84.05cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAACAAGTGCGAAAAATGCOvergo seq fw:AAGTGTGATCTCACCTCACAGAAA
Reverse primer:TCCTCTGATCTGCACAGTCGOvergo seq rv: TCTCGGTGGACACGACTTTCTGTG
Tm:58.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS806Mimulus unigene:MgU5049Phytome id:mgut2044
 Arabidopsis homolog:At3g45300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCTTGCAATGAGTGAACCOvergo seq fw:
Reverse primer:AGAACAAAACCACCGTCTGCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MgSTS807Mimulus unigene:MgU5067Phytome id:mgut2047
 Arabidopsis homolog:At4g29400
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 31.65cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAGCTTCCATATTCAGATCCOvergo seq fw:
Reverse primer:TTGGATGTTTTGGTCAATGCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MgSTS808Mimulus unigene:MgU5092Phytome id:mgut2055
 Arabidopsis homolog:At3g51850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCCCAGTTTTCATCATGGOvergo seq fw:
Reverse primer:GAGTTGATGATTGTACAGATGTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS809Mimulus unigene:MgU5147Phytome id:mgut2082
 Arabidopsis homolog:At5g22480
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCCAATTCCTCGTTCTGCOvergo seq fw:CCAATTCCTCGTTCTGCTCCCAAG
Reverse primer:ATGATGCTTTGGCAAATTCCOvergo seq rv: GAGGAATACGAGAGATCTTGGGAG
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS810Mimulus unigene:MgU5153Phytome id:mgut2086
 Arabidopsis homolog:At3g07680
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 86.97cM

Set:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGAGCAGCACTGGTTAGAGGOvergo seq fw:GAGGGGTCATGGCATTACAGTGAA
Reverse primer:CAGACCGCTGGCTAGAACCOvergo seq rv: CAAGGTCTACACCATCTTCACTGT
Tm:61.1Tm:65.40
IM62 length0BAC contig(s):MgFPC2670, MlFPC1616
    
MgSTS811Mimulus unigene:MgU5154Phytome id:mgut2087
 Arabidopsis homolog:At1g32070
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 106.65cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTGTCGAGAGAACCAGACCOvergo seq fw:
Reverse primer:AGCTTTGACAGTGGCCTACGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MgSTS812Mimulus unigene:MgU5181Phytome id:mgut2091
 Arabidopsis homolog:At5g35910
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAATGGAGAGATGTCGTTGCOvergo seq fw:GCATGGAGCAGACCGTGATATCAT
Reverse primer:AGCTGGCTAGTGGTGAGAGGOvergo seq rv: GTCTCGTTGAAGCCATATGATATC
Tm:58.2Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS813Mimulus unigene:MgU5201Phytome id:mgut2098
 Arabidopsis homolog:At5g48960
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGGTCTGTGGGACAAAAGCOvergo seq fw:TCTCTTTAACCAACTACGCCTTGC
Reverse primer:GCTCGGAAATACATGAATGGOvergo seq rv: ACTCCGTCTCTGCAGAGCAAGGCG
Tm:60.7Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS814Mimulus unigene:MgU5209Phytome id:mgut2100
 Arabidopsis homolog:At1g36050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGAAGTGCAAGAACGAAACGOvergo seq fw:
Reverse primer:CAAATGCAATGTATCAGTATTTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS815Mimulus unigene:MgU5212Phytome id:mgut2103
 Arabidopsis homolog:At3g48750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGGAACCACACTTCTGAGCOvergo seq fw:
Reverse primer:CACGCCAAATGAAGATATATGGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MgSTS816Mimulus unigene:MgU5213Phytome id:mgut2104
 Arabidopsis homolog:At4g16570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 76.48cM
M. guttatus IM62_x_DUN RILs(2009)1 67.73cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTTGCGCAATGTACCTACCOvergo seq fw:
Reverse primer:AGAGGCAAATCTCCACATGCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MgSTS817Mimulus unigene:MgU5217Phytome id:mgut2106
 Arabidopsis homolog:At3g62600
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 125.08cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCCACCAAATGTTCATCGOvergo seq fw:
Reverse primer:CACCTCATGATCGCTTCAGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MgSTS818Mimulus unigene:MgU5227Phytome id:mgut2112
 Arabidopsis homolog:At4g36690
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 82.73cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGATGCGATCTGTTGAAGAGGOvergo seq fw:CCCCCGCCATTCCTCCGATGTTTC
Reverse primer:CGGTCGTCTCACTTTAACTGGOvergo seq rv: TGTGGTAACATATTAGGAAACATC
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS819Mimulus unigene:MgU5230Phytome id:mgut2114
 Arabidopsis homolog:At5g65940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCTTAACAACGGCATACGGOvergo seq fw:
Reverse primer:TTGGACAAGGACAAAAATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS820Mimulus unigene:MgU5235Phytome id:mgut2116
 Arabidopsis homolog:At5g06140
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 73.21cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGCTTCAGCAAAGTGAGGOvergo seq fw:
Reverse primer:CCAGTTTCCTGGGATCTTGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS821Mimulus unigene:MgU5239Phytome id:mgut2119
 Arabidopsis homolog:At5g35080
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGTTTTCACCTTCGGTTCCOvergo seq fw:
Reverse primer:CATGCAAGTATGCACTCACGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MgSTS822Mimulus unigene:MgU5256Phytome id:mgut2128
 Arabidopsis homolog:At5g48370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 83.11cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTGTCAGCCACAACAGAGGOvergo seq fw:GGCCGGATATTTGGAGGGTTTCTG
Reverse primer:AGGCTGATCCGAAGTCTCGOvergo seq rv: CAAATGCTCTGTGCATCAGAAACC
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):MgFPC215, MlFPC1185, MlFPC1913, MlFPC497, MlFPC650
    
MgSTS823Mimulus unigene:MgU5282Phytome id:mgut2137
 Arabidopsis homolog:At4g04350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTCGCTTACGAGCCTTTCCOvergo seq fw:
Reverse primer:CTGTGCACGTTTTCTCAACCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MgSTS824Mimulus unigene:MgU5288Phytome id:mgut2139
 Arabidopsis homolog:At1g19140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGGAGGTTGGTGTTTCTCCOvergo seq fw:
Reverse primer:AGGGAGCCTGCATTTCTAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS825Mimulus unigene:MgU5289Phytome id:mgut2140
 Arabidopsis homolog:At2g24765
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGCAGTTCCAATGACTCCOvergo seq fw:
Reverse primer:GAGCTTAAAGGTGCTGTTGTCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS826Mimulus unigene:MgU5292Phytome id:mgut2143
 Arabidopsis homolog:At3g51800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGTGATGAGACCGTTTTGGOvergo seq fw:
Reverse primer:GCAGCAGCAATAACATCAGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MgSTS827Mimulus unigene:MgU5304Phytome id:mgut2150
 Arabidopsis homolog:At5g25757
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 16.68cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 13.56cM

Set:D2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCTTGCGGCTTACATGGOvergo seq fw:GAAAGCTTGCGGCTTACATGGAAG
Reverse primer:GCGTTTGAGGTGATTTTTCCOvergo seq rv: AAGGTAGGCTCATCGACTTCCATG
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS828Mimulus unigene:MgU5349Phytome id:mgut2168
 Arabidopsis homolog:At5g16440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCCACTTCATCTGGATTCGOvergo seq fw:
Reverse primer:CGCTGCTCAAGACGTTCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):