Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (600 - 699) out of 1979 markers

MgSTS629Mimulus unigene:MgU3653Phytome id:mgut1457
 Arabidopsis homolog:At5g08380
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATCCAGAGCAGACGAGAACGOvergo seq fw:TGGGATTCGAGGAACTAGACGCGA
Reverse primer:TTTCGTCATTCCTCCATTGCOvergo seq rv: CATTCGGCAAAGGTTTTCGCGTCT
Tm:60.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS630Mimulus unigene:MgU3654Phytome id:mgut1458
 Arabidopsis homolog:At1g13060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTGGAGTTCTCCAACATCGOvergo seq fw:
Reverse primer:GCTTATGGTGTTTTGGACAGCOvergo seq rv:
Tm:57.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS631Mimulus unigene:MgU3684Phytome id:mgut1474
 Arabidopsis homolog:At1g64200
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 117.70cM
M. guttatus IM62_x_DUN RILs(2009)14 112.90cM

Set:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTAGAAGCCAGCACCACACCOvergo seq fw:AACACAATCTTCCCATCTCTAGAA
Reverse primer:AGCGGACTTCCATTTTGTGGOvergo seq rv: GAGGTGTGGTGCTGGCTTCTAGAG
Tm:60.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC92, MlFPC1305
    
MgSTS632Mimulus unigene:MgU3693Phytome id:mgut1478
 Arabidopsis homolog:At2g33840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 87.20cM

Set:D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTCCCCACTGACATAATCAGCOvergo seq fw:TCCTTAACTTTGGGATCATTGGTG
Reverse primer:GTTTTCCCATGGTTCAACGOvergo seq rv: CGGTGCGTGATCATTTCACCAATG
Tm:60.0Tm:63.35
IM62 lengthBAC contig(s):
    
MgSTS633Mimulus unigene:MgU3701Phytome id:mgut1483
 Arabidopsis homolog:At4g10040
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 102.74cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GGACTGCCTTCCAAAAAGCOvergo seq fw:
Reverse primer:TGTCACACCGTCGATAAAGGOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS634Mimulus unigene:MgU3721Phytome id:mgut1490
 Arabidopsis homolog:At5g64300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 93.69cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGTTGATTCGAGGGAGTACGOvergo seq fw:
Reverse primer:CAACAGCCAAACCGTAACCOvergo seq rv:
Tm:60.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS635Mimulus unigene:MgU3733Phytome id:mgut1497
 Arabidopsis homolog:At3g20630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 99.42cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGGGTAGATGTGCCTATGTGGOvergo seq fw:
Reverse primer:TAGCAGTGGAAATGCTGTCGOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS636Mimulus unigene:MgU3735Phytome id:mgut1498
 Arabidopsis homolog:At5g64290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAACTAATGCCCATGTCACCOvergo seq fw:
Reverse primer:CGCATTATAGTAGCGGTCAAGCOvergo seq rv:
Tm:58.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS637Mimulus unigene:MgU3759Phytome id:mgut1508
 Arabidopsis homolog:At2g40300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 37.70cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATGGCCTTTACCGACTCTCCOvergo seq fw:
Reverse primer:GGCCGACTTTGTTGAGAGCOvergo seq rv:
Tm:60.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS638Mimulus unigene:MgU3791Phytome id:mgut1523
 Arabidopsis homolog:At2g25610
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 36.90cM
M. guttatus IM62_x_DUN RILs(2009)9 65.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 33.30cM

Set:D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACTCAGAGCAGGCTACGCOvergo seq fw:TAGTTCAGATCTCACCGTACACCT
Reverse primer:TTTTGTGCGTCTGACAAAGCOvergo seq rv: ATTCCGATGGAGGCGAAGGTGTAC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS639Mimulus unigene:MgU3801Phytome id:
 Arabidopsis homolog:At5g08180
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 42.19cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 76.61cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:overgo designed but not yet included in a set
Forward primer:ACCGAGTTCACCCTTGACCOvergo seq fw:
Reverse primer:TGTGTGAAGAAGCTAACATACCGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MgSTS640Mimulus unigene:MgU3814Phytome id:mgut1531
 Arabidopsis homolog:At3g52390
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACCCTGCAGGTGTTATGGOvergo seq fw:GCTGATCGATGTCTGCAATACCTT
Reverse primer:CGGACTGCCTCGTTAAAGGOvergo seq rv: GTAGTGGCTGGCTGTAAAGGTATT
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS641Mimulus unigene:MgU3833Phytome id:mgut1540
 Arabidopsis homolog:At1g27970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 103.88cM
M. guttatus IM62_x_DUN RILs(2009)5 5.38cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 0.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:overgo designed but not yet included in a set
Forward primer:GGCAATCTTCAGCTCTCTGGOvergo seq fw:
Reverse primer:GCTGCCTTGAGGTGTTGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS642Mimulus unigene:MgU3836Phytome id:mgut1541
 Arabidopsis homolog:At5g46180
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATACAGCCTGGAGAGCATGGOvergo seq fw:GCTGACAAAGATGTTATGCTCTGC
Reverse primer:TGTTGTCGAAGCTGTTGTCCOvergo seq rv: GCTCTCCAGGCTGTATGCAGAGCA
Tm:60.2Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS643Mimulus unigene:MgU3853Phytome id:mgut1545
 Arabidopsis homolog:At1g62940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGTCGGAGATCAAGAAGCOvergo seq fw:
Reverse primer:GTTGTGCCTGATGAGAATGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MgSTS644Mimulus unigene:MgU3859Phytome id:mgut1546
 Arabidopsis homolog:At2g27020
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)11 16.51cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGGTTGTGGTGTAATTCTGGOvergo seq fw:
Reverse primer:CTTCCTTTTCCAATGGATGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MgSTS645Mimulus unigene:MgU3862Phytome id:mgut1548
 Arabidopsis homolog:At5g04740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 36.48cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGGCATTGGAACATCATCGOvergo seq fw:
Reverse primer:GTGTGTGCCTCTGTTGATGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS646Mimulus unigene:MgU3880Phytome id:
 Arabidopsis homolog:At5g43830
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 44.93cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGGCATTGCAGTTTTTCCOvergo seq fw:
Reverse primer:AAGTCTTTTGCCCCATTTCCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MgSTS647Mimulus unigene:MgU3881Phytome id:mgut1561
 Arabidopsis homolog:At3g55530
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAGGTTGCAAGGTCTTAGGCOvergo seq fw:GGTTGCAAGGTCTTAGGCTCCAAC
Reverse primer:GCTGCAGGAACATTGTCAGCOvergo seq rv: CGATCAAGAAGTGCAAGTTGGAGC
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS648Mimulus unigene:MgU3906Phytome id:mgut1572
 Arabidopsis homolog:At3g07760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 99.84cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGGGATGTCGATGTTTACGOvergo seq fw:
Reverse primer:AGGCCTGCGTACCTTTTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MgSTS649Mimulus unigene:MgU3922Phytome id:mgut1580
 Arabidopsis homolog:At2g25740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 3.34cM
M. guttatus IM62_x_DUN RILs(2009)5 72.46cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTCCTAATGCCCCAAAAGGOvergo seq fw:
Reverse primer:GTCCGGTTAAGGAGTTCAGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS650Mimulus unigene:MgU3941Phytome id:mgut1592
 Arabidopsis homolog:At3g27930
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 4.00cM
M. guttatus IM62_x_DUN RILs(2009)8 0.92cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 5.23cM

Set:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGAAGATTATGGCGTCATGGOvergo seq fw:GTGACGTGGATGATCCCCACACGT
Reverse primer:TCCCATCTTGCTTACCAACCOvergo seq rv: ACAAAGAGATCGACAAACGTGTGG
Tm:59.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS651Mimulus unigene:MgU4007Phytome id:mgut1619
 Arabidopsis homolog:At3g50830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGTTGGAAGGTGGATTGCOvergo seq fw:
Reverse primer:TGTCCCCTTATCGAATCAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS652Mimulus unigene:MgU4033Phytome id:mgut1631
 Arabidopsis homolog:At2g46700
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCCATTGGTCCTCAACCOvergo seq fw:CCGAGCCAATTCCTCAACCGATAT
Reverse primer:AGCTTTTGACCATTTTGAGCOvergo seq rv: AGAGGGTAACCGAGTAATATCGGT
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS653Mimulus unigene:MgU4060Phytome id:mgut1643
 Arabidopsis homolog:At5g64350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGGAGCCTTTTTCTTTCCOvergo seq fw:
Reverse primer:ACTTCTCCCACTTGCATTCCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS654Mimulus unigene:MgU4064Phytome id:mgut1645
 Arabidopsis homolog:At3g18080
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)4 65.13cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 57.04cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTACGATAACGGATTCTTTGCOvergo seq fw:ATCCCATGCTGCTGCTGCTCAGCG
Reverse primer:AACAGGATCCCGATTCTTCCOvergo seq rv: ATATTTCTGGCGATATCGCTGAGC
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS655Mimulus unigene:MgU4075Phytome id:mgut1651
 Arabidopsis homolog:At3g22170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCGGGTATTCTGTGTATCGOvergo seq fw:
Reverse primer:TGTTGCATGCTTTCTGTTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MgSTS656Mimulus unigene:MgU4085Phytome id:mgut1655
 Arabidopsis homolog:At1g53240
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 71.46cM

Set:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTATGCAGGTGCCATATTCGOvergo seq fw:CCTGTGATTGGCGGTCATGCTGGA
Reverse primer:TTCAACTCGGGTTTGAGAGCOvergo seq rv: AAGGTAGAATAGTGACTCCAGCAT
Tm:59.5Tm:65.40
IM62 length0BAC contig(s):MlFPC1130, MlFPC116, MlFPC19, MlFPC25
    
MgSTS657Mimulus unigene:MgU4101Phytome id:mgut1664
 Arabidopsis homolog:At5g55590
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCTTCTATCAGCTCCTCTGCOvergo seq fw:CTTCTATCAGCTCCTCTGCCTCTG
Reverse primer:TTCGACGTCAATGTCAGACCOvergo seq rv: TCGGAGAATACGAATGCAGAGGCA
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS658Mimulus unigene:MgU4104Phytome id:mgut1666
 Arabidopsis homolog:At1g68850
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 3.70cM

Set:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTCCACGATTGCTTTGTCCOvergo seq fw:CACGCAATGCAGCCTTAATCCTCC
Reverse primer:AAAACCGACCCATCACACCOvergo seq rv: TCGTGGAAATGTAACCGGAGGATT
Tm:61.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS659Mimulus unigene:MgU2797Phytome id:
 Arabidopsis homolog:At5g41190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCATGGCATTTCAACACCOvergo seq fw:
Reverse primer:GCTGCTTCAGATTGGTTTACGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MgSTS660Mimulus unigene:MgU3181Phytome id:mgut1239
 Arabidopsis homolog:At3g51800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAATCATGCCATTTTCTGCOvergo seq fw:
Reverse primer:CAGGCTTCTCATGAAGTACAGGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MgSTS661Mimulus unigene:MgU2989Phytome id:mgut1166
 Arabidopsis homolog:At2g19740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 76.34cM
M. guttatus IM62_x_DUN RILs(2009)14 68.49cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACACAATCAACCTTCACAAGCOvergo seq fw:
Reverse primer:GCGAACTTTCTTATTTCTTTGATAGCOvergo seq rv:
Tm:57.7Tm:
IM62 length0BAC contig(s):
    
MgSTS662Mimulus unigene:MgU3414Phytome id:mgut1348
 Arabidopsis homolog:At2g40110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 45.24cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTGAGCCACATTTGACGOvergo seq fw:
Reverse primer:TATGCAGGCATGGGAAGGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MgSTS663Mimulus unigene:MgU3011Phytome id:mgut1178
 Arabidopsis homolog:At1g53850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGCAATGTAATGCAAAAGCOvergo seq fw:
Reverse primer:GAAAGTGCAATCGTTTCAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MgSTS664Mimulus unigene:MgU3492Phytome id:
 Arabidopsis homolog:At5g63400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAACGCAAGGATGATACAGCOvergo seq fw:
Reverse primer:TGAAGATTTGCAACGACACCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS665Mimulus unigene:MgU3602Phytome id:
 Arabidopsis homolog:At1g12410
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 73.33cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTGCAAAGCGATTACCCOvergo seq fw:
Reverse primer:ATGCAAAGCCTGAAAAGTGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MgSTS666Mimulus unigene:MgU3679Phytome id:mgut1471
 Arabidopsis homolog:At3g20800
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 97.07cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTCTGCCTGATACGTTCCOvergo seq fw:
Reverse primer:GATCGAATCCAACTCCTTGCOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MgSTS667Mimulus unigene:MgU3731Phytome id:
 Arabidopsis homolog:At5g66760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGCCAGGAAAGAAAGTAGAGGOvergo seq fw:
Reverse primer:ACTGGTCGGTAATCCAGTCGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS668Mimulus unigene:MgU3753Phytome id:mgut1506
 Arabidopsis homolog:At5g19220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTACGATGCAGCGAAGCOvergo seq fw:
Reverse primer:GACGCTGTGCTCGATTAAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS669Mimulus unigene:MgU3784Phytome id:mgut1519
 Arabidopsis homolog:At4g02010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCTGAGTATGCAATGACTGGOvergo seq fw:
Reverse primer:TATTTTCAAGCCTCGGATCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MgSTS670Mimulus unigene:MgU3898Phytome id:mgut1565
 Arabidopsis homolog:At3g55800
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACACGTTGCGATACACAGGOvergo seq fw:GAGAAATACACGTTGCGATACACA
Reverse primer:TCGTTTTTCGATCCGTAAGCOvergo seq rv: CAGGGACCATTCCTCCTGTGTATC
Tm:58.2Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS671Mimulus unigene:MgU3907Phytome id:
 Arabidopsis homolog:At3g51240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTCACCACTGCTTGATGGOvergo seq fw:
Reverse primer:AGATGGTGGGGAAACATGGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MgSTS672Mimulus unigene:MgU6009Phytome id:mgut2400
 Arabidopsis homolog:At1g77710
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 0.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCAACCGCAATTCTGACCOvergo seq fw:
Reverse primer:GGGAATTAATCCTCAACAAAGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS673Mimulus unigene:MgU4026Phytome id:
 Arabidopsis homolog:At3g25860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATCGGCTGTAACATTCACCOvergo seq fw:
Reverse primer:GGGGCTATTATGGCTGTGGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MgSTS674Mimulus unigene:MgU4200Phytome id:
 Arabidopsis homolog:At5g60590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 25.03cM
M. guttatus IM62_x_DUN RILs(2009)4 111.83cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACGGCTTTGCTTGTGATGCOvergo seq fw:
Reverse primer:CAGCAAAGCGTTGTATGTCGOvergo seq rv:
Tm:62.3Tm:
IM62 length0BAC contig(s):
    
MgSTS675Mimulus unigene:MgU4212Phytome id:mgut1684
 Arabidopsis homolog:At5g67590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 43.22cM
M. guttatus IM62_x_DUN RILs(2009)8 5.20cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGTTGGTGGAAATCAAAGCOvergo seq fw:
Reverse primer:CCGGATCCTTGTTGAGTAGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MgSTS676Mimulus unigene:MgU4213Phytome id:mgut1685
 Arabidopsis homolog:At1g13450
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 87.62cM
M. guttatus IM62_x_DUN RILs(2009)5 29.38cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 23.81cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGGAAACTACACTCTTCACGOvergo seq fw:
Reverse primer:AACAAGTCCACCGCCTACGOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MgSTS677Mimulus unigene:MgU4229Phytome id:mgut1689
 Arabidopsis homolog:At2g36930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGGGGAGAGTAAATCATTGCOvergo seq fw:
Reverse primer:TCCCTCACCTCCACATTAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MgSTS678Mimulus unigene:MgU4231Phytome id:
 Arabidopsis homolog:At3g08860
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 4.43cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGAGGCAGGGGATTAATGGOvergo seq fw:
Reverse primer:CTTTCCCGACCAATATACCGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MgSTS679Mimulus unigene:MgU4231Phytome id:
 Arabidopsis homolog:At3g08860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGGTGGACTTGCTGTGCOvergo seq fw:
Reverse primer:GGCTTTCGAACAAGACTGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MgSTS680Mimulus unigene:MgU4232Phytome id:
 Arabidopsis homolog:At3g10920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGCTTTACAGGGATCTGGOvergo seq fw:
Reverse primer:TGCTCCCAGACATCAATACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MgSTS681Mimulus unigene:MgU4239Phytome id:mgut1692
 Arabidopsis homolog:At1g52600
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 34.59cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACGGCACCACATCATGGOvergo seq fw:GTCGTTGTCGTTCTTTCTGGAAGC
Reverse primer:AATAGCGAGGAAACCTAATGCOvergo seq rv: GAAATCCGGGTTCCATGCTTCCAG
Tm:61.4Tm:65.40
IM62 length0BAC contig(s):MlFPC103, MlFPC294, MlFPC327, MlFPC6, MlFPC693
    
MgSTS682Mimulus unigene:MgU4241Phytome id:mgut1694
 Arabidopsis homolog:At3g26370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 89.46cM

Set:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTTTACGGTGGACAGAACCOvergo seq fw:GGACAGAACCGCATGGCACCACTT
Reverse primer:CGGTGTCCCATGTATCTTCGOvergo seq rv: TAGGGAACATGTTTCTAAGTGGTG
Tm:59.3Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS683Mimulus unigene:MgU4243Phytome id:
 Arabidopsis homolog:At1g17650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTCAGCCAATCCCAGAGCOvergo seq fw:
Reverse primer:TGAGAAAGTAGGCCTCGATCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MgSTS684Mimulus unigene:MgU4252Phytome id:
 Arabidopsis homolog:At1g11820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGGGTCATGCTTCTTACGCOvergo seq fw:
Reverse primer:CCGGGAAATATGCAACTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS685Mimulus unigene:MgU4273Phytome id:mgut1701
 Arabidopsis homolog:At1g23360
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACAATGTAGTGGTTCCTGTGGOvergo seq fw:CGCTGCAACCATTGGCTACGGGCT
Reverse primer:CATCGATCTCGTAATGTTTGCOvergo seq rv: ATGTACTACGTTTCTTAGCCCGTA
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS686Mimulus unigene:MgU4275Phytome id:
 Arabidopsis homolog:At4g27600
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTTCTCACAACTCCGGATGCOvergo seq fw:TTCTCTTTCTAACACCTTGGTGGC
Reverse primer:GCACGGATCGTAGTTTACCCOvergo seq rv: ACCAAGCCTTGCCAAGGCCACCAA
Tm:60.7Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS687Mimulus unigene:MgU4288Phytome id:mgut1705
 Arabidopsis homolog:At3g06050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGTCTCCCTCCAGAAAGCOvergo seq fw:
Reverse primer:TGCTGTGCTGAACAAACACCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MgSTS688Mimulus unigene:MgU4294Phytome id:mgut1706
 Arabidopsis homolog:At1g51710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACGCATAAGGGTAGAAGTGCOvergo seq fw:
Reverse primer:CGAGAGTCTGGTGATGTCTTCCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MgSTS689Mimulus unigene:MgU4301Phytome id:mgut1710
 Arabidopsis homolog:At1g08830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTCTTCCACCAGCATTTCCOvergo seq fw:
Reverse primer:ACCCTGATGATCTTGGAAGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MgSTS690Mimulus unigene:MgU4307Phytome id:mgut1711
 Arabidopsis homolog:At2g20420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 57.79cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 14.08cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGATGTTGGTGGAAATGCOvergo seq fw:
Reverse primer:TCAAGACGAACAACCACAGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MgSTS691Mimulus unigene:MgU4312Phytome id:
 Arabidopsis homolog:At4g02680
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 108.77cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCCACTTCGGGTTTATCCOvergo seq fw:TTGGACCCACTTCGGGTTTATCCT
Reverse primer:TTGCCTTCGACAGTTCTTCCOvergo seq rv: CGGCTCGATATCTGTAAGGATAAA
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):MlFPC1066, MlFPC597
    
MgSTS692Mimulus unigene:MgU4318Phytome id:
 Arabidopsis homolog:At1g66430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTCCGTCACAGTCAACGOvergo seq fw:
Reverse primer:GGCAGGAATCTTGTCACAGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS693Mimulus unigene:MgU4329Phytome id:
 Arabidopsis homolog:At2g01970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGGCGTTGACATACTTCCOvergo seq fw:
Reverse primer:CGGTAGATCCACCACATAGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MgSTS694Mimulus unigene:MgU4330Phytome id:mgut1718
 Arabidopsis homolog:At2g44920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTAGGGGCCAGCTTCTTCGOvergo seq fw:
Reverse primer:AGTGCTCCTTCGAGGTTGGOvergo seq rv:
Tm:62.8Tm:
IM62 length0BAC contig(s):
    
MgSTS695Mimulus unigene:MgU4340Phytome id:mgut1722
 Arabidopsis homolog:At2g05990
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCAAAAGCTATTGGATTTATCGOvergo seq fw:GGCATGAGCTCTGCAAAAGCAGCG
Reverse primer:CAATGGCGATACCAAGAAGGOvergo seq rv: TTGTATCACTCTCTAGCGCTGCTT
Tm:60.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS696Mimulus unigene:MgU4342Phytome id:
 Arabidopsis homolog:At1g26940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 69.11cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACACATTTTCAAGCTTGTTCGOvergo seq fw:
Reverse primer:TTCTTCCGCTAGCAACATCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MgSTS697Mimulus unigene:MgU4347Phytome id:
 Arabidopsis homolog:At1g04970
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCAAAGAAGCAGATAAGATGGOvergo seq fw:CTCGACTTAGAAATCGACGGGCTA
Reverse primer:CGATAATCGGTGGAGAAAACGOvergo seq rv: CGTTCTTGGCAGAGAATAGCCCGT
Tm:59.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS698Mimulus unigene:MgU4355Phytome id:mgut1726
 Arabidopsis homolog:At5g47090
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 39.85cM
M. guttatus IM62_x_DUN RILs(2009)5 77.21cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTCCTCGCAAGGTACAACCOvergo seq fw:TACTTTCCTCGCAAGGTACAACCC
Reverse primer:ACACGTCGAAATGACTCAGCOvergo seq rv: AATCAGTTGCAGCGGAGGGTTGTA
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS699Mimulus unigene:MgU6131Phytome id:
 Arabidopsis homolog:At1g49760
Genetic markerPhysical marker
Map:Not MappedSet:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTGTTGCATTCTCGTCACCOvergo seq fw:CGCCTTGATCAGAGTCTGAAAGAA
Reverse primer:TCCTTCTTTTGAGCGAGAGCOvergo seq rv: GGGAATTTTCAGCCGCTTCTTTCA
Tm:59.7Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS700Mimulus unigene:MgU4375Phytome id:
 Arabidopsis homolog:At3g13490
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 132.37cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGTTCGTCAACAGCATCACGOvergo seq fw:ATCACGTATACTAGCCGAGTTCGT
Reverse primer:ATGCAGCGAAAACAACATCGOvergo seq rv: GCTCGTGATGCTGTTGACGAACTC
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):MlFPC1, MlFPC145, MlFPC255, MlFPC39, MlFPC7
    
MgSTS701Mimulus unigene:MgU1951Phytome id:
 Arabidopsis homolog:At5g43940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 58.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 97.19cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATCATGCATCAGATCAAACGOvergo seq fw:CCTCAGGCAGACACCATCATGCAT
Reverse primer:CCAAGTACCTTGGCTTGTGGOvergo seq rv: CAAAGCGTTTGATCTGATGCATGA
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):MgFPC251, MlFPC1210, MlFPC32
    
MgSTS702Mimulus unigene:MgU2067Phytome id:mgut853
 Arabidopsis homolog:At1g68540
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 43.01cM
M. guttatus IM62_x_DUN RILs(2009)12 56.39cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:GGCGAAATACCCGTCTTACCOvergo seq fw:
Reverse primer:TCCCTTTTCTCGAAAACTCGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MgSTS703Mimulus unigene:MgU1535Phytome id:
 Arabidopsis homolog:At1g26880
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)12 75.69cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCGGATCGTCAAAACTCCOvergo seq fw:
Reverse primer:TCCAGTAACAGGGCATTTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MgSTS704Mimulus unigene:MgU2503Phytome id:mgut1016
 Arabidopsis homolog:At3g44890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAATTTACTGGGGAAGAAAGGOvergo seq fw:
Reverse primer:CTCAGCCTCGATTCTGTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MgSTS705Mimulus unigene:MgU3082Phytome id:
 Arabidopsis homolog:At4g01150
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGCCAATTCTCTTCTACTCGOvergo seq fw:GGAAGCTAACCACACTGAAACAAC
Reverse primer:GGTTAGCTTCCATTGTTGTCGOvergo seq rv: TTACGGAGGTGGTGCAGTTGTTTC
Tm:59.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS706Mimulus unigene:MgU2991Phytome id:
 Arabidopsis homolog:At4g03280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACATCTTGGTTGTGTTGTGCOvergo seq fw:
Reverse primer:GCCAAAGCCAAAGAGAGAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MgSTS707Mimulus unigene:MgU6051Phytome id:
 Arabidopsis homolog:At5g57330
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTACTGAACGAGGGGATGCOvergo seq fw:CCCCACCTCCGTTTCCTACCACTA
Reverse primer:TCAGGAAGGCCATCTTTACGOvergo seq rv: AATGTCTTATTGGAGGTAGTGGTA
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS708Mimulus unigene:MgU3880Phytome id:
 Arabidopsis homolog:At5g43830
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 46.21cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTCTTTTGCCCCATTTCCOvergo seq fw:
Reverse primer:GCTTCGTAGACCTCCAGACGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MgSTS709Mimulus unigene:MgU3924Phytome id:mgut1581
 Arabidopsis homolog:At5g42000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTGCCATTTTCTATTTGCOvergo seq fw:
Reverse primer:GGACCGTCGTTCATCTCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MgSTS710Mimulus unigene:MgU2822Phytome id:
 Arabidopsis homolog:At2g33770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 60.65cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 68.42cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTCGTCGTTCGAAGTGCOvergo seq fw:CCTCGTCGTTCGAAGTGCTCCTTC
Reverse primer:CTGAGGGCGAAAAGAACTCGOvergo seq rv: ATTTTGAGGCACTAGTGAAGGAGC
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS711Mimulus unigene:MgU4383Phytome id:mgut1730
 Arabidopsis homolog:At1g02190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 80.17cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 71.39cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGCCTTATGCCAAGATGGOvergo seq fw:
Reverse primer:CCATGTCTTGGGAGTATTGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MgSTS712Mimulus unigene:MgU2151Phytome id:
 Arabidopsis homolog:At1g16470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)5 77.21cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTCCTTCAGTGTCAAAATGGOvergo seq fw:CGACTTCCTGCAAGTAATCCTCCA
Reverse primer:CCAATGCAAAGACATTTCTGGOvergo seq rv: TTGACCGCTTCTGAAGTGGAGGAT
Tm:57.3Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS713Mimulus unigene:MgU4388Phytome id:
 Arabidopsis homolog:At5g63670
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 126.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 123.62cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAAGGGCAGTTCTCACACCOvergo seq fw:CGTTTCGGTGGAACATAAGGCACA
Reverse primer:TTGCACAAATTCCAACAAGCOvergo seq rv: TTTGTGAAGAGGAGCGTGTGCCTT
Tm:59.7Tm:65.40
IM62 length0BAC contig(s):MgFPC177, MlFPC36, MlFPC416
    
MgSTS714Mimulus unigene:MgU4391Phytome id:mgut1732
 Arabidopsis homolog:At4g14320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:TTATGGTGGACAAACCAAGCOvergo seq fw:
Reverse primer:TAGGGTGCTGGGAACTATGCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MgSTS715Mimulus unigene:MgU4392Phytome id:
 Arabidopsis homolog:At1g48350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGCAGAAACCCATCTCGOvergo seq fw:
Reverse primer:AAGGCCACCTTCGTTATTCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MgSTS716Mimulus unigene:MgU4393Phytome id:mgut1733
 Arabidopsis homolog:At5g06150
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 35.00cM

Set:B / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAACACCCCCTTTCTCAGCOvergo seq fw:ATGTTCCGCCGCACTCGAATGATA
Reverse primer:ATTGCACACCGGTTTTTCCOvergo seq rv: GAAGCTGTTGGTTTCGTATCATTC
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):MgFPC480, MgFPC766
    
MgSTS717Mimulus unigene:MgU4398Phytome id:
 Arabidopsis homolog:At5g28840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 41.31cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTTTCTACGCCTCAAGTGCOvergo seq fw:GGAGGGATGGGCTTCATTCAGTCA
Reverse primer:GTCGCCAGCTTCTCTAGACCOvergo seq rv: TAATGACGGAGTGGTTTGACTGAA
Tm:58.2Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS718Mimulus unigene:MgU4400Phytome id:
 Arabidopsis homolog:At1g29310
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 107.82cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATCCTCCGCTAAAGATGTGGOvergo seq fw:TCTCGGGATCCTCCGCTAAAGATG
Reverse primer:GATACACATCCCACCAAAAGCOvergo seq rv: TTGAGCTGTTTAGCCACATCTTTA
Tm:59.1Tm:65.40
IM62 length0BAC contig(s):MlFPC317, MlFPC371, MlFPC684
    
MgSTS719Mimulus unigene:MgU3247Phytome id:
 Arabidopsis homolog:At1g10950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGACCCCAGATATCCAACCOvergo seq fw:
Reverse primer:TGAGAACTATCATTGGCAGTGGOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MgSTS720Mimulus unigene:MgU6014Phytome id:
 Arabidopsis homolog:At3g11630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 1.88cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGACAAGGAGGGAGTTATCCOvergo seq fw:TCTTCTTCTACCCACTGGACTTCA
Reverse primer:CTTCATCGGGGTTATCTTGCOvergo seq rv: GTGGGGCAAACAAAGGTGAAGTCC
Tm:58.1Tm:65.40
IM62 length0BAC contig(s):MgFPC1361, MgFPC138, MgFPC2156, MgFPC2960, MlFPC1, MlFPC1878, MlFPC1908, MlFPC1913, MlFPC456, MlFPC58
    
MgSTS721Mimulus unigene:MgU6123Phytome id:
 Arabidopsis homolog:At3g09200
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 64.64cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCGTGTTGGTTTGGTAGCCOvergo seq fw:CCACTCTGAGAACACTGGGAACAA
Reverse primer:GGCCTGATTTCGAGTTTCGOvergo seq rv: TAGGGCAAGGATAGCTTTGTTCCC
Tm:60.5Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS722Mimulus unigene:MgU2988Phytome id:mgut1165
 Arabidopsis homolog:At1g36240
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATCTCGGACTTCCTCAACGOvergo seq fw:GGCATGAAACACGGAAATACTTCC
Reverse primer:GGCTCTTGTGATGAAGAGTGGOvergo seq rv: CTTGGTACAGCATGCGGGAAGTAT
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS723Mimulus unigene:MgU3801Phytome id:
 Arabidopsis homolog:At5g08180
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 40.31cM
M. guttatus IM62_x_DUN RILs(2009)6 34.28cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCGAGTTCACCCTTGACCOvergo seq fw:
Reverse primer:CCGTATGTCTACGTTACATCAAAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MgSTS724Mimulus unigene:MgU4411Phytome id:
 Arabidopsis homolog:At4g25570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)6 17.87cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 85.65cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCCGGGGTAGAAAAACACCOvergo seq fw:GATCCTCCGGGGTAGAAAAACACC
Reverse primer:AGTCTGCACTCTTGGCTTGGOvergo seq rv: GGCTTTACGGTTTTGTGGTGTTTT
Tm:60.7Tm:65.40
IM62 length0BAC contig(s):MgFPC2676, MlFPC73, MlFPC872
    
MgSTS725Mimulus unigene:MgU1383Phytome id:
 Arabidopsis homolog:At1g75610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACAGACCGACGAGGTAAGCOvergo seq fw:
Reverse primer:GTTCCAGCGTTTGGTTCGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MgSTS726Mimulus unigene:MgU1852Phytome id:mgut783
 Arabidopsis homolog:At1g08830
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTTTGCTGAGTTCATGTCCOvergo seq fw:TCCACCAGCATTTCCAGTGGCTTT
Reverse primer:ACCCTGATGATCTTGGAAGGOvergo seq rv: TGGACATGAACTCAGCAAAGCCAC
Tm:58.4Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS727Mimulus unigene:MgU1936Phytome id:
 Arabidopsis homolog:At4g31700
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 0.00cM
M. guttatus IM62_x_DUN RILs(2009)12 4.20cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCAGCCTCTGAATCTTTGGOvergo seq fw:CAGTGGGGTAACCAGCCTCTGAAT
Reverse primer:TGTGAAAAAGGGTGACAACGOvergo seq rv: AAGCAAAGCACCAAAGATTCAGAG
Tm:59.3Tm:65.40
IM62 length0BAC contig(s):MgFPC2768, MlFPC1, MlFPC913
    
MgSTS728Mimulus unigene:MgU2486Phytome id:mgut1006
 Arabidopsis homolog:At2g26330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCTTCACGAGGCACAAGGOvergo seq fw:
Reverse primer:CGTTGATGATGAATTGAATCTCCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):