Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (500 - 599) out of 1979 markers

MgSTS529Mimulus unigene:MgU2771Phytome id:
 Arabidopsis homolog:At5g40950
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 0.80cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 100.06cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGAAGAATGTTGGGCTTGGOvergo seq fw:CCAAAGCTGGTTCCATTATTGTAC
Reverse primer:GTGCAGCAGAAGCAAGTACCOvergo seq rv: TTGGTACCGCGTTGGCGTACAATA
Tm:60.4Tm:65.40
IM62 lengthBAC contig(s):MlFPC116, MlFPC993
    
MgSTS530Mimulus unigene:MgU2842Phytome id:
 Arabidopsis homolog:At3g61440
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 68.60cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTCTCAGCTTCTTTCCTCAGCOvergo seq fw:
Reverse primer:AAGAAGGCCTGAAAACAAGGOvergo seq rv:
Tm:59.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS531Mimulus unigene:MgU4155Phytome id:
 Arabidopsis homolog:At5g58420
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGAACTTCCGTCTTCTGCOvergo seq fw:
Reverse primer:CTGAATCGAACGGACTTTGCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS532Mimulus unigene:MgU1827Phytome id:mgut777
 Arabidopsis homolog:At3g52590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCTTCGTGAAAACCCTCACCOvergo seq fw:
Reverse primer:CCATCTTCAAGCTGCTTTCCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS533Mimulus unigene:MgU2279Phytome id:
 Arabidopsis homolog:At4g10450
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 0.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGATCGGACGATTGAAACCOvergo seq fw:
Reverse primer:TACCGCCTCTATTCGTACCGOvergo seq rv:
Tm:60.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS534Mimulus unigene:MgU1920Phytome id:
 Arabidopsis homolog:At3g49010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCCCAGCTTGTTGTCTTCCOvergo seq fw:
Reverse primer:TTCACAAGCTCGACAGATGGOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS535Mimulus unigene:MgU1221Phytome id:
 Arabidopsis homolog:At3g11940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 4.60cM
M. guttatus Irn Mtn Combined(2009)3 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATGGAAATCATCCACTTGCOvergo seq fw:GGCTGTTCGCATCATCAAGCATGC
Reverse primer:AACACCAGCTGAACCAATCCOvergo seq rv: GTGGATGATTTCCATGGCATGCTT
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC453, MlFPC209, MlFPC31
    
MgSTS536Mimulus unigene:MgU2825Phytome id:
 Arabidopsis homolog:At1g32470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 84.80cM
M. guttatus Irn Mtn Combined(2009)9 0.00cM
M. guttatus IM62_x_DUN RILs(2009)9 4.09cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 77.07cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTGGAGGGGTTCAAATATGCOvergo seq fw:GGCTCTCTTCTTCTTCTTCCTCTT
Reverse primer:CTCCACAAACACCACTTCTCCOvergo seq rv: GCAGGAGCGAATCTAGAAGAGGAA
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC1757, MgFPC283, MgFPC770, MgFPC995, MlFPC1213
    
MgSTS537Mimulus unigene:MgU1882Phytome id:
 Arabidopsis homolog:At5g40370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 9.00cM
M. guttatus Irn Mtn Combined(2009)8 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:
Forward primer:GGTGAGCAACGGAACAAGCOvergo seq fw:
Reverse primer:CCGAATGTGTTCATCAGTGGOvergo seq rv:
Tm:61.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS538Mimulus unigene:MgU1942Phytome id:mgut806
 Arabidopsis homolog:At1g11910
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 98.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 72.87cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTCCGGCATGAGTGAAGCOvergo seq fw:GCAAAGAATGCAAGTCTGTGGTCG
Reverse primer:GCGAGATCGAATTTCTTTCCOvergo seq rv: GTTTGCCCGTATTTATCGACCACA
Tm:60.4Tm:63.35
IM62 lengthBAC contig(s):MgFPC2856, MgFPC726, MlFPC194, MlFPC25
    
MgSTS539Mimulus unigene:MgU1793Phytome id:
 Arabidopsis homolog:At5g02960
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 58.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 80.44cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTCACCTTGGAAATGAATGGOvergo seq fw:CATCGCAGAAGGCAAAGGTGGGCT
Reverse primer:TGGACCCTAGCACACTTACGOvergo seq rv: TCTTGTATGACTTGTCAGCCCACC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC422, MlFPC1597, MlFPC161, MlFPC970
    
MgSTS540Mimulus unigene:MgU4143Phytome id:
 Arabidopsis homolog:At4g17390
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCCAAGGGTATTGTGTATGGOvergo seq fw:
Reverse primer:AGTTGTATGCGCTGGATCGOvergo seq rv:
Tm:59.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS541Mimulus unigene:MgU78Phytome id:
 Arabidopsis homolog:At3g54890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATGGGTTGCCAAGTTCTCCOvergo seq fw:
Reverse primer:GGGTAAAGGCACAAGAATGGOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS542Mimulus unigene:MgU2891Phytome id:mgut1146
 Arabidopsis homolog:At1g02780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 39.09cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGTTTGAGGCCAAGAGAGCOvergo seq fw:GCAAGGGGAAGGTTTGGCTTGATC
Reverse primer:GTGCAGGAGTTGGAGTTGGOvergo seq rv: TCACTGCCTTCATTAGGATCAAGC
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):MgFPC2549, MgFPC277, MgFPC2908, MgFPC2983, MgFPC576, MgFPC66, MgFPC81, MlFPC1809, MlFPC3, MlFPC702
    
MgSTS543Mimulus unigene:MgU2903Phytome id:
 Arabidopsis homolog:At2g25737
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)1 9.18cM

Set:D2
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:ATTCTTGCCGGTTTGGTAGGOvergo seq fw:TCATGGGCCCACTCTTTCTCGAAT
Reverse primer:AAGAGAACATCATGGCAAAGGOvergo seq rv: TGAGGAGGAATGCCTAATTCGAGA
Tm:61.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS544Mimulus unigene:MgU2782Phytome id:
 Arabidopsis homolog:At5g19510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCTGTCGGAGTGAGAATTGGOvergo seq fw:
Reverse primer:GGTCGTCGTCATCATCAGCOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS545Mimulus unigene:MgU2729Phytome id:
 Arabidopsis homolog:At1g02140
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 38.92cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 75.75cM

Set:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCCAATTGTTATCATCTTCCOvergo seq fw:GGGCTTGATCTTGAAGTGCAGTGA
Reverse primer:CGCATCGTCTCCGATTCCOvergo seq rv: CGTCTTCTCTCTGATCTCACTGCA
Tm:58.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS546Mimulus unigene:MgU1877Phytome id:
 Arabidopsis homolog:At2g32720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 0.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGGAACCAAGAACTGAAGGOvergo seq fw:
Reverse primer:GATGACGTCTTATTGTCTTCAACCOvergo seq rv:
Tm:59.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS547Mimulus unigene:MgU2777Phytome id:
 Arabidopsis homolog:At1g79560
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)13 75.01cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 80.85cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATGACAGTTGAAGTTTCTGAGCOvergo seq fw:CGAGACAGAGGAACTTGCTATGAA
Reverse primer:AACAGTTGTTGGGCAATCGOvergo seq rv: GTTGTCTCTCAGTCCCTTCATAGC
Tm:59.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS548Mimulus unigene:MgU2521Phytome id:
 Arabidopsis homolog:At1g69500
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)12 66.40cM
M. guttatus Irn Mtn Combined(2009)12 64.50cM
M. guttatus IM62_x_DUN RILs(2009)12 71.81cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 14.43cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCACTTTGTGCCCTTTCACCOvergo seq fw:TTCATCTGCAGATATGCAGAGTCC
Reverse primer:ATATTCCAGAACGCGTCACCOvergo seq rv: GGATATGCCTCGGGAAGGACTCTG
Tm:61.1Tm:65.40
IM62 lengthBAC contig(s):MlFPC1226, MlFPC1508
    
MgSTS549Mimulus unigene:MgU1550Phytome id:
 Arabidopsis homolog:At3g02080
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TATTGTGAAAACCGGAGTGCOvergo seq fw:
Reverse primer:AAGCACCGACACCAAGACCOvergo seq rv:
Tm:58.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS550Mimulus unigene:MgU1775Phytome id:mgut766
 Arabidopsis homolog:At5g60040
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 83.05cM
M. guttatus IM62_x_DUN RILs(2009)3 3.25cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTTTCTGCACACCGTACCOvergo seq fw:CCCTGTGCCGATTTGGACCGGTAT
Reverse primer:GAGTTGAGGGTCGAAAGACGOvergo seq rv: ATGCATTATTATGGGCATACCGGT
Tm:59.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS551Mimulus unigene:MgU2048Phytome id:
 Arabidopsis homolog:At4g29060
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGAGGGCTTTCTTGCAGTCCOvergo seq fw:GGCTTCGACTGAAGATCCTCTCTC
Reverse primer:GCTGCTGAAACTGAGGAAGCOvergo seq rv: AACAGTTGGAGATGCAGAGAGAGG
Tm:60.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS552Mimulus unigene:MgU1686Phytome id:
 Arabidopsis homolog:At5g51830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTTGTTCGACTTCCTCTTTCGOvergo seq fw:
Reverse primer:TGAAGTCCGTTGACACAACCOvergo seq rv:
Tm:59.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS553Mimulus unigene:MgU1261Phytome id:
 Arabidopsis homolog:At4g29520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)11 60.48cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GATGACGTGACGGATTTTCCOvergo seq fw:
Reverse primer:TGCATCCACTACTCCTTTCGOvergo seq rv:
Tm:60.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS554Mimulus unigene:MgU2921Phytome id:
 Arabidopsis homolog:At1g01630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 49.15cM

Set:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACGCAGTTTCTTGCTCTCGOvergo seq fw:GTTCTTCCGTTCCTCCTTTGCTGG
Reverse primer:AAGTGTTCATGATCCACGTACCOvergo seq rv: GGTGCTAAGCATTTTCCCAGCAAA
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):MgFPC540, MlFPC1419
    
MgSTS555Mimulus unigene:MgU2927Phytome id:
 Arabidopsis homolog:At3g10850
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACTACCCTCGGTTCTTTGCOvergo seq fw:CCAAAGAAGGAGATGTGCCTGCCG
Reverse primer:CATTCTCTGGTTCCACAGTCGOvergo seq rv: GTGTCACCAGTAAAAACGGCAGGC
Tm:59.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS556Mimulus unigene:MgU2931Phytome id:
 Arabidopsis homolog:At1g24510
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATGATGCTTTATGCGTTGCOvergo seq fw:AATGCATAGAGAGTTACCTGCTGT
Reverse primer:GCTGGAGACCACTATTTTCTGCOvergo seq rv: GCCTCCAACCCATCGAACAGCAGG
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS557Mimulus unigene:MgU2932Phytome id:mgut1153
 Arabidopsis homolog:At3g20320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTCGGAAGCTCGTGTAAGGOvergo seq fw:
Reverse primer:CATTGACTGAACGGGTTGCOvergo seq rv:
Tm:58.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS558Mimulus unigene:MgU2944Phytome id:mgut1156
 Arabidopsis homolog:At1g53850
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 5.30cM
M. guttatus Irn Mtn Combined(2009)9 76.51cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 3.88cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTCGAATATGCCATTGAAGCOvergo seq fw:GGAGTATGATAGAGGAGTCAATAC
Reverse primer:TCCACGGCAAGAACTACTCCOvergo seq rv: GCCTTCAGGAGAGAAAGTATTGAC
Tm:58.2Tm:63.35
IM62 lengthBAC contig(s):MgFPC111, MgFPC565, MlFPC1146, MlFPC1900, MlFPC263, MlFPC425, MlFPC447, MlFPC567, MlFPC856
    
MgSTS559Mimulus unigene:MgU2950Phytome id:
 Arabidopsis homolog:At3g04920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTGCTCTGTTTTTCCTTTCCOvergo seq fw:
Reverse primer:GAGGTTAAGGACCCGAATGCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS560Mimulus unigene:MgU2966Phytome id:
 Arabidopsis homolog:At2g07050
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 6.72cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAACCTTACGAACGAATACGGOvergo seq fw:
Reverse primer:GCTCCATTTGAGGTGTGTCGOvergo seq rv:
Tm:59.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS561Mimulus unigene:MgU1913Phytome id:
 Arabidopsis homolog:At1g62940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 70.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 64.85cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATGGTTGGCTTCACACAGGOvergo seq fw:CTTCACACAGGGGATATCGGTTAC
Reverse primer:AGGATTGCCTCCAATTCAGCOvergo seq rv: CTCCGTCATCGTCTATGTAACCGA
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS562Mimulus unigene:MgU1519Phytome id:
 Arabidopsis homolog:At3g04400
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 20.30cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTGTTATTGTTAACCCCAAGGOvergo seq fw:AATTGAGGAAGAAGGTCATGCCAG
Reverse primer:AATGGCATTAGCTGCACTAGCOvergo seq rv: TGCCTGACGATGACAGCTGGCATG
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC2272, MgFPC251, MlFPC1157, MlFPC1596, MlFPC381
    
MgSTS563Mimulus unigene:MgU1502Phytome id:
 Arabidopsis homolog:At5g61170
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 24.00cM
M. guttatus IM62_x_DUN RILs(2009)8 5.96cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 15.89cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAACTGGTGTGCTGAAAGAGCOvergo seq fw:AAAATGTCAAGGACGTCTCTCCCC
Reverse primer:GCTTCCACCGTAAATTCTCCOvergo seq rv: GCTTTGACGAACTCGTGGGGAGAG
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):MlFPC284, MlFPC337, MlFPC397, MlFPC621, MlFPC709
    
MgSTS564Mimulus unigene:MgU1753Phytome id:
 Arabidopsis homolog:At5g35530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTCCTTTGGAGGATGAATCGOvergo seq fw:
Reverse primer:GTGAGTGGCAAGTTGAGAGCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS565Mimulus unigene:MgU4171Phytome id:
 Arabidopsis homolog:At3g60245
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 94.20cM
M. guttatus IM62_x_DUN RILs(2009)2 76.15cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 63.40cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGTGCTAGTTTGAGGAAGCOvergo seq fw:GTGAGTCAGCACAGCAAATATTTC
Reverse primer:CTCCCTAAGCCTTCTGATCGOvergo seq rv: TTCCGCAGAACTCGCAGAAATATT
Tm:58.1Tm:64.38
IM62 lengthBAC contig(s):MgFPC278, MgFPC609, MlFPC1312, MlFPC1592, MlFPC1679, MlFPC1908, MlFPC21, MlFPC466, MlFPC613, MlFPC752, MlFPC789
    
MgSTS566Mimulus unigene:MgU4139Phytome id:
 Arabidopsis homolog:At3g09630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCGACAAGAAGAGGAAGCOvergo seq fw:
Reverse primer:GCCACTTTGTGAAGTTGTCGOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS567Mimulus unigene:MgU4127Phytome id:
 Arabidopsis homolog:At4g34670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCTCAGCTACAGCTTCTTCGOvergo seq fw:
Reverse primer:CAGGAAGGTCAAGATATTGAAAGCOvergo seq rv:
Tm:58.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS568Mimulus unigene:MgU2990Phytome id:mgut1167
 Arabidopsis homolog:At1g77940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCACTTGTGGTGAAGAGTGGOvergo seq fw:
Reverse primer:AATTTCCGACTTCCTCAACGOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS569Mimulus unigene:MgU3003Phytome id:
 Arabidopsis homolog:At5g15200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGCACGTCTGTGTTTATCGOvergo seq fw:
Reverse primer:CGTACTGAACCCTCCACAGCOvergo seq rv:
Tm:57.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS570Mimulus unigene:MgU3012Phytome id:
 Arabidopsis homolog:At2g21280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACCAAGAACAGCTTTGAGGOvergo seq fw:
Reverse primer:TTCGTGGATTCATGTTGACGOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS571Mimulus unigene:MgU3019Phytome id:mgut1180
 Arabidopsis homolog:At1g03630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 74.20cM
M. guttatus Irn Mtn Combined(2009)8 66.13cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 51.97cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCTTTCTCTGCATCACTCGOvergo seq fw:CCAGTACACCCCCGATTTCGACAG
Reverse primer:CTCTACCCCGGTTGTATTGCOvergo seq rv: AATAAGTGATCCAAGCCTGTCGAA
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):MlFPC1178, MlFPC591
    
MgSTS572Mimulus unigene:MgU3020Phytome id:
 Arabidopsis homolog:At1g61580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCCATGCAAGCTAACAGCOvergo seq fw:
Reverse primer:TGATAGTCACAGCCTCACAGGOvergo seq rv:
Tm:60.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS573Mimulus unigene:MgU3043Phytome id:
 Arabidopsis homolog:At4g09800
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 117.48cM

Set:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATCGCTTCTTGGAGACACCOvergo seq fw:AACAGTCTTTCCCCTACGACCAGT
Reverse primer:TCCTCGTCAGTTCAAGATTCCOvergo seq rv: ACAGCACACCAAGACTACTGGTCG
Tm:60.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC349, MgFPC515, MlFPC1237, MlFPC417
    
MgSTS574Mimulus unigene:MgU778Phytome id:mgut3366
 Arabidopsis homolog:At1g75670
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 35.68cM
M. guttatus IM62_x_DUN RILs(2009)7 70.75cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTTGGAGGAGTTGTGTTAGCOvergo seq fw:AATTTGGTCGTGCATTTGCACCCG
Reverse primer:GAAATCCCAAGAACCACAGCOvergo seq rv: CGGATTTAGCCTTCGACGGGTGCA
Tm:57.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS575Mimulus unigene:MgU1610Phytome id:mgut723
 Arabidopsis homolog:At5g19330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGAGATGCTAAAGACATAGAGATCCOvergo seq fw:
Reverse primer:AATTACGAGTCTCGGGTAAAATACGOvergo seq rv:
Tm:59.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS576Mimulus unigene:MgU2105Phytome id:mgut865
 Arabidopsis homolog:At5g19760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACAACCGCACGTCTTGGOvergo seq fw:
Reverse primer:GCATGCCCATGTTAAGTGCOvergo seq rv:
Tm:62.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS577Mimulus unigene:MgU2219Phytome id:
 Arabidopsis homolog:At5g27620
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 29.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCATGGACTTTCAGATCTCCOvergo seq fw:GAGGTTCTATTTGCGGTGGTCTGT
Reverse primer:TCCTTTGACCTGTGCTTTCGOvergo seq rv: TGGATGATGTTCCATCACAGACCA
Tm:60.2Tm:64.38
IM62 lengthBAC contig(s):MgFPC2178, MgFPC619
    
MgSTS578Mimulus unigene:MgU1564Phytome id:
 Arabidopsis homolog:At3g60210
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 79.90cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 69.70cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGATGTTCCCAAATCAACCOvergo seq fw:CCGCCAGCAAATCACTAGCTTTGC
Reverse primer:GAGGTTGAGGAAGTGGAAACCOvergo seq rv: GCAAGGCATTGTTTCTGCAAAGCT
Tm:57.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS579Mimulus unigene:MgU2426Phytome id:mgut979
 Arabidopsis homolog:At3g51820
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 98.90cM
M. guttatus IM62_x_DUN RILs(2009)10 12.96cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 124.23cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:
Forward primer:GGCGATTAAGCCTACAAGTGCOvergo seq fw:GCCTACAAGTGCTAAAGCGTAATA
Reverse primer:TGCAAAGTGGATATGTGTTGGOvergo seq rv: GGGTGCCGGTAAACCATATTACGC
Tm:61.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS580Mimulus unigene:MgU2647Phytome id:
 Arabidopsis homolog:At2g21170
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)1 20.50cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGGATAACATTGTGGTTGCOvergo seq fw:
Reverse primer:TGCTCCTCCCACTAGAAATCCOvergo seq rv:
Tm:59.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS581Mimulus unigene:MgU2677Phytome id:
 Arabidopsis homolog:At1g19600
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 47.47cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGCATTGCGAAACACGOvergo seq fw:
Reverse primer:AACCCGCTCGCAAATAGGOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS582Mimulus unigene:MgU2696Phytome id:
 Arabidopsis homolog:At5g13710
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)2 66.98cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGCAGTTTCCGTTTGTCTGCOvergo seq fw:
Reverse primer:GTCCTTCTGCAGCTTTCTCCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS583Mimulus unigene:MgU2761Phytome id:
 Arabidopsis homolog:At2g21870
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 146.60cM
M. guttatus IM62_x_DUN RILs(2009)14 134.84cM

Set:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTATGATGAGTGACGCACTGGOvergo seq fw:GCAGAGGCTATGATGAGTGACGCA
Reverse primer:TTTGGGCAGATCTTCTTTACGOvergo seq rv: TCTCAACTTTGTCCAGTGCGTCAC
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):MlFPC1703, MlFPC96
    
MgSTS584Mimulus unigene:MgU2789Phytome id:
 Arabidopsis homolog:At4g01100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAAACTGTCAGGCATGAGGOvergo seq fw:
Reverse primer:GCAATTCCTTCACTTGTTCGOvergo seq rv:
Tm:58.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS585Mimulus unigene:MgU3080Phytome id:
 Arabidopsis homolog:At1g43170
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAAACTTGGAAGAGGTGTCGOvergo seq fw:GGCAGTGTGCTCTTCTTTACCGAT
Reverse primer:CGGTAAAGAAGAGCACACTGCOvergo seq rv: CTACAGGCTTGGAAAGATCGGTAA
Tm:58.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS586Mimulus unigene:MgU3094Phytome id:mgut1213
 Arabidopsis homolog:At3g53020
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)5 37.30cM
M. lewisii x M. cardinalis(2009)2+4 37.40cM

Set:
Guttatus map status:map position determinedPhys map status:overgo designed but not yet included in a set
Forward primer:ATTGTCGGTGCCACTTTGGOvergo seq fw:
Reverse primer:CACCTCCTCCGAGCTTAGGOvergo seq rv:
Tm:61.9Tm:
IM62 lengthBAC contig(s):MgFPC2647, MgFPC2691, MgFPC435
    
MgSTS587Mimulus unigene:MgU3098Phytome id:
 Arabidopsis homolog:At1g13950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AATCCATCCTCAGAGATGTCGOvergo seq fw:
Reverse primer:GCAATCGACATCTTCACTTCCOvergo seq rv:
Tm:59.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS588Mimulus unigene:MgU3102Phytome id:mgut1214
 Arabidopsis homolog:At3g59980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGGCCTTGTCAAATACATCCOvergo seq fw:
Reverse primer:CATTCCAAACGATTTCACACCOvergo seq rv:
Tm:60.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS589Mimulus unigene:MgU3110Phytome id:mgut1217
 Arabidopsis homolog:At3g23890
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 82.90cM
M. guttatus Irn Mtn Combined(2009)2 65.51cM
M. guttatus IM62_x_DUN RILs(2009)2 66.96cM

Set:D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCATCTGTTTGACTCCAAAGGOvergo seq fw:GAGCACTAGTAACATGCATCTGTT
Reverse primer:CAGCTCAAGGAACAAATCAGCOvergo seq rv: TACGCCTTTGGAGTCAAACAGATG
Tm:59.7Tm:63.35
IM62 lengthBAC contig(s):
    
MgSTS590Mimulus unigene:MgU3117Phytome id:
 Arabidopsis homolog:At5g09770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 71.10cM
M. guttatus Irn Mtn Combined(2009)8 67.82cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 134.34cM

Set:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGATACACAAGATTGCTTCGOvergo seq fw:CGAAATTCAGGAAGCTCAATCGCC
Reverse primer:GCCATTTGTCTGGTGAGTCGOvergo seq rv: ATTCTGTGGCCTGTGGGGCGATTG
Tm:58.8Tm:66.43
IM62 lengthBAC contig(s):
    
MgSTS591Mimulus unigene:MgU3121Phytome id:
 Arabidopsis homolog:At1g55740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATTGCCTGTTTTCCGATCCOvergo seq fw:
Reverse primer:GACGATTGCATCTCCATTCCOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS592Mimulus unigene:MgU3127Phytome id:
 Arabidopsis homolog:At1g35470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 5.67cM
M. guttatus IM62_x_DUN RILs(2009)3 57.73cM

Set:
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:CAAGGACTTGTCAGGGTTCGOvergo seq fw:
Reverse primer:ATCTGTCATCTTCGGGTTGGOvergo seq rv:
Tm:60.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS593Mimulus unigene:MgU3139Phytome id:
 Arabidopsis homolog:At4g31300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGCTTCGATTTCTTCATGCOvergo seq fw:
Reverse primer:GGGATGACTCGAGAAGAAGCOvergo seq rv:
Tm:62.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS594Mimulus unigene:MgU3140Phytome id:
 Arabidopsis homolog:At5g01650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAGATCATCGGCAAACCOvergo seq fw:
Reverse primer:GAGACCAGCTCCCCATAAGCOvergo seq rv:
Tm:61.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS595Mimulus unigene:MgU2384Phytome id:mgut958
 Arabidopsis homolog:At5g15080
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 70.95cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTAACCAAATTCGGATGAACCOvergo seq fw:
Reverse primer:AGGATGGATCGAAGAGAACGOvergo seq rv:
Tm:58.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS596Mimulus unigene:MgU2725Phytome id:mgut1091
 Arabidopsis homolog:At3g46460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCTTCGTTCTCTCCATTCCOvergo seq fw:
Reverse primer:TCCTAACGGATATGAGCTTGCOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS597Mimulus unigene:MgU3154Phytome id:mgut1226
 Arabidopsis homolog:At2g05710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCTCCATGGTCGAAGTACGOvergo seq fw:
Reverse primer:GAAACACTTGGCTTGACAGGOvergo seq rv:
Tm:59.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS598Mimulus unigene:MgU3162Phytome id:
 Arabidopsis homolog:At3g11980
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 8.30cM
M. guttatus Irn Mtn Combined(2009)11 66.11cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGAAGATTTCTCCTCTCACCOvergo seq fw:GGTCGAGCAAGCTAAGTACTTGGC
Reverse primer:ACACCCCATCAATCTTTTCGOvergo seq rv: GGACTCGTAGATGTTAGCCAAGTA
Tm:58.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS599Mimulus unigene:MgU3174Phytome id:mgut1234
 Arabidopsis homolog:At2g42910
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 51.90cM
M. guttatus Irn Mtn Combined(2009)13 73.11cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 24.49cM

Set:C / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGTAACGGGGCATGAATCGOvergo seq fw:GGGGCATGAATCGCTTATCCAAAA
Reverse primer:TGTTCCCAAAGAAGTCATGGOvergo seq rv: GAAGGCGTTCACACACTTTTGGAT
Tm:60.9Tm:65.40
IM62 lengthBAC contig(s):MlFPC105, MlFPC112, MlFPC1881, MlFPC25, MlFPC357, MlFPC582
    
MgSTS600Mimulus unigene:MgU3184Phytome id:mgut1240
 Arabidopsis homolog:At3g44830
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 10.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 8.47cM

Set:D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTCTTTTCTCTGCCGAAGCOvergo seq fw:CGAAAGCCGTTTCTGGTCTTTTCT
Reverse primer:GAATCCCATGTCCTAGTCATCCOvergo seq rv: TCTCTAGCTTCGGCAGAGAAAAGA
Tm:61.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC1712, MgFPC273, MgFPC3005, MgFPC604
    
MgSTS601Mimulus unigene:MgU3196Phytome id:mgut1245
 Arabidopsis homolog:At2g35110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 102.68cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTTGGAATGAAAGCAATCGOvergo seq fw:GCCTAGATTTGCAGTCTCGAGATC
Reverse primer:TATTGGCTGTACACGGAACGOvergo seq rv: GTACGATATTGGACCGGATCTCGA
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS602Mimulus unigene:MgU3205Phytome id:mgut1248
 Arabidopsis homolog:At2g39960
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)6 87.96cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAGTCCTTCAACATCCTTCCOvergo seq fw:
Reverse primer:CCAGTCGATATCTGCAAAAGCOvergo seq rv:
Tm:59.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS603Mimulus unigene:MgU3258Phytome id:
 Arabidopsis homolog:At3g11780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 64.52cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTGCTTCTTCTTCCCATCCOvergo seq fw:
Reverse primer:TCTCTCACTCCCAGGTTTTACCOvergo seq rv:
Tm:59.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS604Mimulus unigene:MgU3262Phytome id:mgut1278
 Arabidopsis homolog:At3g29320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGTTGAGGTAATGCGAGTGCOvergo seq fw:
Reverse primer:ATGACGTGGGAGAAGACTGCOvergo seq rv:
Tm:58.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS605Mimulus unigene:MgU3263Phytome id:
 Arabidopsis homolog:At3g11980
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 66.09cM
M. guttatus IM62_x_DUN RILs(2009)11 0.00cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCTCCACAATGGATCACTTCCOvergo seq fw:
Reverse primer:TGCCACCCATATTTCTTTGCOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS606Mimulus unigene:MgU3278Phytome id:mgut1285
 Arabidopsis homolog:At5g10460
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 113.80cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 6.79cM

Set:D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTCGTGGCAAGAGAATTAACCOvergo seq fw:GTCTCCAACAGCAATACAGTCAGC
Reverse primer:GGGGAAGTGAAGTGGATGGOvergo seq rv: GGTTGGTGTAGATGCTGCTGACTG
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):MlFPC618, MlFPC720, MlFPC742
    
MgSTS607Mimulus unigene:MgU3294Phytome id:mgut1294
 Arabidopsis homolog:At5g14600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCCTTCTCGAACTTCATACGOvergo seq fw:
Reverse primer:GTGCAGAAATCTTGCGAAGCOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS608Mimulus unigene:MgU3297Phytome id:mgut1295
 Arabidopsis homolog:At3g55620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCTCTCAACTTGAAAACACTCTCGOvergo seq fw:
Reverse primer:TTACTGTGCACTTTCAAATAGAGGOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS609Mimulus unigene:MgU3303Phytome id:mgut1298
 Arabidopsis homolog:At3g08710
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 108.30cM
M. guttatus Irn Mtn Combined(2009)10 106.46cM
M. guttatus IM62_x_DUN RILs(2009)10 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 131.33cM

Set:C
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCCCTTGTAAAATGATTGCOvergo seq fw:GGGAGCAAAAGCTGGCAGAAGCAA
Reverse primer:AAGAAGAAGGTTGGGGTTGCOvergo seq rv: ATCTTTCCGTCTCGTTTTGCTTCT
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS610Mimulus unigene:MgU3313Phytome id:mgut1305
 Arabidopsis homolog:At3g02090
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 18.84cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGGTCATGCAGTCTATGTTGGOvergo seq fw:
Reverse primer:AAAGCCATCATGCTCTCTGCOvergo seq rv:
Tm:59.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS611Mimulus unigene:MgU3344Phytome id:mgut1318
 Arabidopsis homolog:At1g54250
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 47.40cM
M. guttatus Irn Mtn Combined(2009)9 41.37cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 40.64cM

Set:D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCGAACGATACGAATATGTCCOvergo seq fw:CCCTTAAGCTGCATCAGAAGCCCA
Reverse primer:CAAGTTCGGCTACGTCATGCOvergo seq rv: TATTCGTATCGTTCGGTGGGCTTC
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):MgFPC2679, MlFPC1268
    
MgSTS612Mimulus unigene:MgU3374Phytome id:mgut1328
 Arabidopsis homolog:At1g72970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)9 73.98cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAAAATCTTCACTCCCATATACCOvergo seq fw:
Reverse primer:ATTGGAGTTGACCGCCTACGOvergo seq rv:
Tm:58.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS613Mimulus unigene:MgU3379Phytome id:mgut1330
 Arabidopsis homolog:At4g22720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCCTGCAGATTTGTGTTACTCCOvergo seq fw:
Reverse primer:CAGTACCGATCGTCAGTTGCOvergo seq rv:
Tm:60.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS614Mimulus unigene:MgU3423Phytome id:mgut1354
 Arabidopsis homolog:At4g39860
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)12 12.33cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATTCCTCGTCGCTCATTGGOvergo seq fw:
Reverse primer:ATATTCCGTTGCCTGTCAGCOvergo seq rv:
Tm:61.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS615Mimulus unigene:MgU3471Phytome id:mgut1377
 Arabidopsis homolog:At1g77120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ACAGATGGAGGAGTGGATCGOvergo seq fw:
Reverse primer:CGAGTCTTTATGAGGCACACCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS616Mimulus unigene:MgU3472Phytome id:mgut1378
 Arabidopsis homolog:At3g04870
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)2 60.86cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCAGATGCAGATTTCTCTTGCOvergo seq fw:GCCAGTTGTCACAGTGCAGCTACG
Reverse primer:TTTGGTAGAGGCATGTACGGOvergo seq rv: AACCCAGCCATTATATCGTAGCTG
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC611, MgFPC976
    
MgSTS617Mimulus unigene:MgU3480Phytome id:mgut1385
 Arabidopsis homolog:At2g04305
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)2 19.44cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGCCTTGGAAGAGTTAATCGOvergo seq fw:
Reverse primer:ATCGTTGGATCTCGTTGTCCOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS618Mimulus unigene:MgU3481Phytome id:mgut1386
 Arabidopsis homolog:At3g12390
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGAAAAGAAGAGTCGCAAGGOvergo seq fw:GCAGAGCAGAAGCGAAAAGAAGAG
Reverse primer:TCTTGAATACATCGGGTTTCGOvergo seq rv: TAGCATTGCCTTGCGACTCTTCTT
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS619Mimulus unigene:MgU3485Phytome id:mgut1387
 Arabidopsis homolog:At4g38930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GAGTCGAAGCCTTCTCATGCOvergo seq fw:
Reverse primer:TGAGCTCGAACTGGATGGOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS620Mimulus unigene:MgU3507Phytome id:mgut1399
 Arabidopsis homolog:At1g04870
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 46.50cM
M. guttatus Irn Mtn Combined(2009)11 39.99cM

Set:C2 / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCAGCTAAGGTCAACTTCCOvergo seq fw:GGTGGAAGTGATTCACCGGACTTT
Reverse primer:CCCCGAGTGAAGATTCTGGOvergo seq rv: GCTGCGAGATCAAACAAAAGTCCG
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS621Mimulus unigene:MgU3555Phytome id:mgut1415
 Arabidopsis homolog:At1g78580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 114.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 92.81cM

Set:C / C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGACTTTTATGCCTTGTGTGCOvergo seq fw:GCCAAGTTCACGAGATCGTTGGGC
Reverse primer:ATGAGAACCCCTCGTTTGGOvergo seq rv: AATCTGCCGTTTATACGCCCAACG
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS622Mimulus unigene:MgU3583Phytome id:mgut1423
 Arabidopsis homolog:At3g13220
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 118.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 85.70cM

Set:
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:overgo designed but not yet included in a set
Forward primer:GAGCAGGGGAATTGTTTGGOvergo seq fw:
Reverse primer:GCGATACGATAAGCCAGTGCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS623Mimulus unigene:MgU3588Phytome id:mgut1424
 Arabidopsis homolog:At2g27230
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 109.58cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTGATGGAGACTCGGAACGOvergo seq fw:GCCTAGGCCGAAAGATCGTCAGAT
Reverse primer:CTCCAGAAGCCGAACTAACGOvergo seq rv: AACACGATCTTGGATCATCTGACG
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS624Mimulus unigene:MgU3617Phytome id:mgut1438
 Arabidopsis homolog:At1g57770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 44.28cM
M. guttatus IM62_x_DUN RILs(2009)2 31.38cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTCGATCGCAGAAGTAACGOvergo seq fw:CGACCCCACAGTGCGAATCGTTTA
Reverse primer:TTAACCTCGCATTTCTCACGOvergo seq rv: CCCAAATGTAGATGCATAAACGAT
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC478, MgFPC852, MlFPC1729
    
MgSTS625Mimulus unigene:MgU3631Phytome id:mgut1442
 Arabidopsis homolog:At2g19450
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGAATTGCAGTTTTGGTTGCOvergo seq fw:GATGGTCCGGCATATATACTTTCC
Reverse primer:CAAAGCTTGAATATGTGACAAGGOvergo seq rv: CCCATTCCGCAAGCATGGAAAGTA
Tm:60.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS626Mimulus unigene:MgU3632Phytome id:mgut1443
 Arabidopsis homolog:At5g18480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATGTTGGTCTTTATATGCTTGCOvergo seq fw:
Reverse primer:CCAATCCCAAGGTTTAAGAGGOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS627Mimulus unigene:MgU3637Phytome id:mgut1447
 Arabidopsis homolog:At1g55150
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 68.27cM

Set:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTCAGAGCTGGCAAGAGTCCOvergo seq fw:GCCAACCATGCAATTCGCCAGCAT
Reverse primer:GTGTATGCGGTTCCTTTTGCOvergo seq rv: CGGAGACAATTTCAACATGCTGGC
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS628Mimulus unigene:MgU3646Phytome id:mgut1452
 Arabidopsis homolog:At1g31860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGACCGACTTGTCACACCOvergo seq fw:
Reverse primer:TTTGCCTGAACTTTCTGACGOvergo seq rv:
Tm:60.9Tm:
IM62 lengthBAC contig(s):