Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (400 - 499) out of 1979 markers

MgSTS425Mimulus unigene:MgU808Phytome id:mgut3527
 Arabidopsis homolog:At1g72180
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 11.16cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGTCACCAGCTCCAATAGCOvergo seq fw:CCAATAGCACCACCCCGAAACTAT
Reverse primer:CTTTTGCAGGCACTCATGGOvergo seq rv: GAGAAAAGCGACGTGTATAGTTTC
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC526, MlFPC1701, MlFPC98
    
MgSTS426Mimulus unigene:MgU809Phytome id:mgut3535
 Arabidopsis homolog:At5g58330
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 106.80cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 12.89cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGATAAACATTGCCGTTTCGOvergo seq fw:TAGAGGACGCCAAGAAGAAACCGG
Reverse primer:GTGCTGTGATGGATCTTTCGOvergo seq rv: AAGACGCCGAAACATTCCGGTTTC
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS427Mimulus unigene:MgU814Phytome id:mgut3569
 Arabidopsis homolog:At1g53730
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)9 77.95cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATGATTGCTCCGATCTTTGCOvergo seq fw:
Reverse primer:TATAGTGCACCGGAGGTTGCOvergo seq rv:
Tm:60.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS428Mimulus unigene:MgU829Phytome id:mgut3679
 Arabidopsis homolog:At3g12050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCAACAAAACCCTTCTCTCCOvergo seq fw:
Reverse primer:GGGTATGATTTTCCCCTTGCOvergo seq rv:
Tm:58.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS429Mimulus unigene:MgU847Phytome id:mgut3815
 Arabidopsis homolog:At5g47820
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 71.56cM
M. guttatus IM62_x_DUN RILs(2009)3 9.43cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTTCCCTTAGCAGAGCAACCOvergo seq fw:
Reverse primer:ATACGCATCTGCTCCATCGOvergo seq rv:
Tm:58.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS430Mimulus unigene:MgU850Phytome id:mgut3834
 Arabidopsis homolog:At2g32230
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 116.00cM
M. guttatus Irn Mtn Combined(2009)6 79.21cM
M. guttatus IM62_x_DUN RILs(2009)6 109.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 5.23cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTGCCTTGGAGTCTCGOvergo seq fw:TCGTCTTCTGTGACAGTCGGTATA
Reverse primer:CCGATTAAAACCTTCTAGTGATGGOvergo seq rv: AACAAGGCAGCTGGCATATACCGA
Tm:57.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS431Mimulus unigene:MgU857Phytome id:mgut3885
 Arabidopsis homolog:At5g24430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 78.20cM
M. guttatus Irn Mtn Combined(2009)6 39.26cM
M. guttatus IM62_x_DUN RILs(2009)6 77.57cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 42.60cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTGTAAATCCAAGAAAACTCAGCOvergo seq fw:GCTGCGAATCGTCACGCCGTGCAA
Reverse primer:CGCAGCATTTCAGTATTTCGOvergo seq rv: TGGATTTACAAAGTTCTTGCACGG
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC2547, MlFPC165, MlFPC50, MlFPC68
    
MgSTS432Mimulus unigene:MgU864Phytome id:mgut3938
 Arabidopsis homolog:At1g53280
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 88.75cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTTCTCGCAGAAACAGTCGOvergo seq fw:CAGTCGCTTCTCAGCTTCAATCAT
Reverse primer:TCTCCGAAGCACATCTATGGOvergo seq rv: TTTAGCAGCGGAAGCCATGATTGA
Tm:61.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS433Mimulus unigene:MgU873Phytome id:mgut4008
 Arabidopsis homolog:At1g26110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ACAACACCACCGATAAACAGCOvergo seq fw:
Reverse primer:CCAAGATCCGCTAAAGATCCOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS434Mimulus unigene:MgU913Phytome id:mgut4290
 Arabidopsis homolog:At1g24510
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCGGATAGAGTTTCGATAGGCOvergo seq fw:CCCCACGTCGTTGCAATCAATACC
Reverse primer:AAGCAGCTGCAGATAAGTACCCOvergo seq rv: GAACAACAGCTACTGTGGTATTGA
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS435Mimulus unigene:MgU930Phytome id:mgut4404
 Arabidopsis homolog:At5g34850
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 52.90cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTTCTTCGACGATTCATTCCOvergo seq fw:CTTCGCGAAATGCGGAATAATCTG
Reverse primer:CCAGATTATTCCGCATTTCGOvergo seq rv: TTTAGGGATCCCCAGCCAGATTAT
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):MlFPC630, MlFPC746
    
MgSTS436Mimulus unigene:MgU942Phytome id:mgut4493
 Arabidopsis homolog:At5g45680
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 28.37cM
M. guttatus IM62_x_DUN RILs(2009)1 16.86cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 24.38cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TAAGCTCCACATCGAACACGOvergo seq fw:CATATCCAAGTGCAGGTGGGATTC
Reverse primer:GAAAACGTGAGCTGAGAATCCOvergo seq rv: GGAAAACGTGAGCTGAGAATCCCA
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC2787, MlFPC1441, MlFPC1680, MlFPC171, MlFPC471
    
MgSTS437Mimulus unigene:MgU969Phytome id:mgut4694
 Arabidopsis homolog:At5g38470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)12 30.90cM
M. guttatus Irn Mtn Combined(2009)12 23.41cM

Set:A
Guttatus map status:map position determinedPhys map status:
Forward primer:CCCTCTCTTCAGGTGTGACGOvergo seq fw:
Reverse primer:CATCAGGCTGACTTCCTTCGOvergo seq rv:
Tm:60.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS438Mimulus unigene:MgU976Phytome id:mgut4747
 Arabidopsis homolog:At5g06600
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)12 110.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 50.70cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTTAGAATACGCCCTTTTAGGOvergo seq fw:AACCCCAGGTACTGCTCCCAAGCA
Reverse primer:CTCTGACATTGTTTCCAGTCGOvergo seq rv: GAAGAGATGTTTATGGTGCTTGGG
Tm:58.3Tm:65.40
IM62 lengthBAC contig(s):MgFPC695, MlFPC1007, MlFPC1392, MlFPC503, MlFPC58
    
MgSTS439Mimulus unigene:MgU987Phytome id:
 Arabidopsis homolog:At1g69830
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 97.05cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 10.07cM

Set:B / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCGCTACAGACCAATTTTCCOvergo seq fw:CCCGTTGTGGGCTCATAGTGACCG
Reverse primer:AAACGGAACACAATCAACTGCOvergo seq rv: TTATGAAAATTGGACCCGGTCACT
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS440Mimulus unigene:MgU988Phytome id:mgut4832
 Arabidopsis homolog:At5g53180
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 92.35cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGAGCCAATAGGAATCAAGCOvergo seq fw:GGAGCTCATCGAACTGGGGAAGCC
Reverse primer:CTTTTCCCTCGTACCTGAGCOvergo seq rv: GACAACTTTACCAAATGGCTTCCC
Tm:58.7Tm:65.40
IM62 lengthBAC contig(s):MgFPC179, MgFPC2183, MgFPC2768, MgFPC2908, MgFPC3005, MgFPC3063, MgFPC3069, MgFPC348, MlFPC12, MlFPC1663, MlFPC633, MlFPC659
    
MgSTS441Mimulus unigene:MgU989Phytome id:mgut4839
 Arabidopsis homolog:At4g13430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 19.51cM
M. guttatus IM62_x_DUN RILs(2009)7 52.50cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TATCTGCGAGCAAGTTTTCCOvergo seq fw:TTCTTTGTGCCCCATTCGACCGGG
Reverse primer:GGGAAAAGGGTGAAAGTTCCOvergo seq rv: GACAAACAGGAATTTCCCCGGTCG
Tm:58.1Tm:65.40
IM62 lengthBAC contig(s):MgFPC478, MlFPC148, MlFPC172, MlFPC954
    
MgSTS442Mimulus unigene:MgU995Phytome id:mgut4885
 Arabidopsis homolog:At5g66120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGGGCTTTAACAGACAAAAACCOvergo seq fw:
Reverse primer:ACCGTCGGTCCATTCTCGOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS443Mimulus unigene:MgU1002Phytome id:mgut17
 Arabidopsis homolog:At3g21300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 67.14cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCGGAGAGAAGTTCGTTGGOvergo seq fw:
Reverse primer:TCCACGATATCCCTGTGTGGOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS444Mimulus unigene:MgU1005Phytome id:
 Arabidopsis homolog:At5g33320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GACGATCACCACCACACGOvergo seq fw:
Reverse primer:CAGCTCTCTGCTTCCATGCOvergo seq rv:
Tm:59.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS445Mimulus unigene:MgU1014Phytome id:mgut106
 Arabidopsis homolog:At5g05520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 41.51cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAGTCTTCCCTTGGTCATGCOvergo seq fw:
Reverse primer:GAGTTGGGATCATTGTACCGOvergo seq rv:
Tm:60.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS446Mimulus unigene:MgU1015Phytome id:mgut114
 Arabidopsis homolog:At5g55230
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)13 82.10cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCCAAAGATGGATTCTTGCOvergo seq fw:
Reverse primer:TGCCATGCTAGACGAGTACGOvergo seq rv:
Tm:58.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS447Mimulus unigene:MgU1024Phytome id:mgut185
 Arabidopsis homolog:At3g54050
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCACCTCATCCACACTTCCOvergo seq fw:AATATGATCGAGCTCGAGTACATG
Reverse primer:TGAGTTTTATTGTGGAGCAAGCOvergo seq rv: TTGCAGCCGGCTACTGCATGTACT
Tm:60.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS448Mimulus unigene:MgU1052Phytome id:mgut374
 Arabidopsis homolog:At2g13360
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 103.12cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 103.44cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGCACCCCAGTAGTTGCOvergo seq fw:ATCAAAGGAGTGGTGTTCTGTAAG
Reverse primer:GTTAGAAGGGCGTGGAAGCOvergo seq rv: CGGCGGCATCTGCTTTCTTACAGA
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):MgFPC289, MgFPC657
    
MgSTS449Mimulus unigene:MgU1064Phytome id:
 Arabidopsis homolog:At5g61780
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CCATCTTCGCCTTTTCTCCOvergo seq fw:TCAGTCAACTCATCCAAAGCTTGC
Reverse primer:GGCAAAGTCAAAGGACAAGGOvergo seq rv: AGCCCAAGGACAAGCAGCAAGCTT
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS450Mimulus unigene:MgU1068Phytome id:mgut468
 Arabidopsis homolog:At4g00660
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 79.80cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGATATTCGGAGGGATCTGCOvergo seq fw:CTTGATCGATATTCGGAGGGATCT
Reverse primer:GTCGATCCGGAAGGTTTGGOvergo seq rv: GGGACCGAGATTAAGCAGATCCCT
Tm:61.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC1232, MgFPC162, MgFPC289, MlFPC141, MlFPC1435, MlFPC1628, MlFPC228, MlFPC261
    
MgSTS451Mimulus unigene:MgU1076Phytome id:mgut474
 Arabidopsis homolog:At4g11030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTCACTGACCGAAGAACAGGOvergo seq fw:
Reverse primer:TGCATATATCAGATGGCTTTGGOvergo seq rv:
Tm:58.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS452Mimulus unigene:MgU1077Phytome id:mgut475
 Arabidopsis homolog:At5g22840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CACCGTCTGGCTAGCTTGGOvergo seq fw:
Reverse primer:CGCTTCGGTATAGTGTTGTGCOvergo seq rv:
Tm:61.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS453Mimulus unigene:MgU1084Phytome id:mgut482
 Arabidopsis homolog:At3g10420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 108.30cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACAGACGGTCCAGATTGAGGOvergo seq fw:GGAACAGACGGTCCAGATTGAGGA
Reverse primer:GAGTGATTAATCCCCGAACGOvergo seq rv: GATAGCATGGGTTAGATCCTCAAT
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS454Mimulus unigene:MgU1105Phytome id:mgut498
 Arabidopsis homolog:At5g05940
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTGTTTTCTACGCCAAACGOvergo seq fw:GCAATCGAGCAAGCAGTCGGATGA
Reverse primer:CACTTCTTTGTCCGAGATGGOvergo seq rv: CACGTCGGAACATTTTTCATCCGA
Tm:60.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS455Mimulus unigene:MgU1467Phytome id:mgut683
 Arabidopsis homolog:At1g27510
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 91.70cM
M. guttatus Irn Mtn Combined(2009)4 42.44cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 76.22cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGATTGGCAAGACGATTAGCOvergo seq fw:AACATACAGAAAACCGAGGTCTGC
Reverse primer:TTTGTATGTTGGTGCATTTGGOvergo seq rv: GCAGTACGTCGAAGGTGCAGACCT
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS456Mimulus unigene:MgU1112Phytome id:mgut502
 Arabidopsis homolog:At3g45010
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 120.30cM
M. guttatus Irn Mtn Combined(2009)6 87.23cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 0.00cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCACCTCTTCAGCATCTCCOvergo seq fw:CTTTAGGCTGATCCATTGGTACCA
Reverse primer:AAGTTGCTTTTGAAGTTGATGGOvergo seq rv: CATGATGCTGGGCACATGGTACCA
Tm:60.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC1808, MgFPC978, MlFPC1366, MlFPC250
    
MgSTS457Mimulus unigene:MgU1150Phytome id:mgut529
 Arabidopsis homolog:At3g54440
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 77.10cM
M. guttatus IM62_x_DUN RILs(2009)2 65.46cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 48.93cM

Set:A
Guttatus map status:map position determinedPhys map status:
Forward primer:TGTGTTTGTGGTCGAAATGCOvergo seq fw:
Reverse primer:GGCGGTTTTGGAATTTATGCOvergo seq rv:
Tm:60.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS458Mimulus unigene:MgU1151Phytome id:mgut530
 Arabidopsis homolog:At4g35780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 23.25cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AAGGGCGGCTTGTAGAGGOvergo seq fw:
Reverse primer:CCGATGTTTTCAGCTTTGCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS459Mimulus unigene:MgU1161Phytome id:mgut539
 Arabidopsis homolog:At2g40320
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 55.10cM
M. guttatus Irn Mtn Combined(2009)6 44.52cM
M. guttatus IM62_x_DUN RILs(2009)6 45.93cM

Set:B / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGTCTCGTTGTAGCAGTTTCCOvergo seq fw:CTCGTTGTAGCAGTTTCCGTTTTC
Reverse primer:GCGATGAAAAGCATGTTGCOvergo seq rv: TGAATGGGGAGGCGATGAAAACGG
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS460Mimulus unigene:MgU1162Phytome id:mgut540
 Arabidopsis homolog:At3g02100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTGACGACCCACAGAAAAGCOvergo seq fw:
Reverse primer:GAATCGGTGGTTTATGTTTCCOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS461Mimulus unigene:MgU1171Phytome id:mgut547
 Arabidopsis homolog:At3g22960
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 22.93cM
M. guttatus IM62_x_DUN RILs(2009)2 10.19cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCCCGTTTACAATTCAAGCOvergo seq fw:ATTGATACCGAGGGGAGTCAAATC
Reverse primer:ACTTCGAAAGTTGCCATTCCOvergo seq rv: CGTGGTCAACGACATGGATTTGAC
Tm:62.7Tm:65.40
IM62 lengthBAC contig(s):MgFPC64, MlFPC192
    
MgSTS462Mimulus unigene:MgU1176Phytome id:mgut549
 Arabidopsis homolog:At5g05580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCAGGATCTCCGACATACGOvergo seq fw:
Reverse primer:CGTAGTGCTGTCAGAGAAACTCCOvergo seq rv:
Tm:58.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS463Mimulus unigene:MgU1311Phytome id:mgut600
 Arabidopsis homolog:At4g30210
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 31.58cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACAATAGCGTGGAGTGTTCGOvergo seq fw:ACATAGCCTCCTTCCGAGATCATA
Reverse primer:CGAGACGGACCGACTAAGGOvergo seq rv: CTGCGGATGTGTGGAATATGATCT
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS464Mimulus unigene:MgU1319Phytome id:
 Arabidopsis homolog:At1g19580
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAGGTCTTGCCTACACTTATCGOvergo seq fw:TCGGCTGCCGCCTCCAGGGAAATT
Reverse primer:AGCAAAGTTGCACCCATACCOvergo seq rv: TGTTCTTGGAAAAAGTAATTTCCC
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS465Mimulus unigene:MgU1336Phytome id:mgut614
 Arabidopsis homolog:At4g29490
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 84.14cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 86.87cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAAGAGCCAGGGTTTTATGGOvergo seq fw:TCTCTCTCTCCTCTCGCCCTCTCC
Reverse primer:ATTTCTCCCAACCAAACTGCOvergo seq rv: AGGAATATGAAACCATGGAGAGGG
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):MgFPC383, MlFPC866
    
MgSTS466Mimulus unigene:MgU1339Phytome id:mgut616
 Arabidopsis homolog:At1g34430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 7.36cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCATGCCGATTCTACCATCCOvergo seq fw:GTCAGCACCGTATATCACACGGTG
Reverse primer:GGTGGACCGTTTTGATGCOvergo seq rv: CAACGTAACTGCAGATCACCGTGT
Tm:60.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS467Mimulus unigene:MgU1340Phytome id:mgut618
 Arabidopsis homolog:At3g58610
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 115.80cM
M. guttatus Irn Mtn Combined(2009)6 77.29cM
M. guttatus IM62_x_DUN RILs(2009)6 115.06cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 5.56cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAACCTCCGTTTTCAGTAAGGOvergo seq fw:CCGGCTTCACAGGATTTCGAAACC
Reverse primer:TGATACCCTTGAATGCATCGOvergo seq rv: CCTTACTGAAAACGGAGGTTTCGA
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC257, MgFPC584, MgFPC830, MlFPC998
    
MgSTS468Mimulus unigene:MgU1341Phytome id:mgut619
 Arabidopsis homolog:At1g72420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 5.90cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTGGACGTCGATGAAGGOvergo seq fw:GACATGGAACCTCGAAGACTTGGT
Reverse primer:CGCATCCAAATCAATGAACCOvergo seq rv: TCTTTCGCTTGGAGGAACCAAGTC
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):MgFPC1881, MgFPC1913, MlFPC1035, MlFPC155, MlFPC231, MlFPC25, MlFPC403, MlFPC464
    
MgSTS469Mimulus unigene:MgU1342Phytome id:mgut620
 Arabidopsis homolog:At1g76550
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 90.67cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTAACTGGCTTCGCATCAGCOvergo seq fw:
Reverse primer:TGTTGATTTGAAGGGGAAGGOvergo seq rv:
Tm:60.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS470Mimulus unigene:MgU1357Phytome id:mgut633
 Arabidopsis homolog:At1g17470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 9.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 7.00cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGACGTGTTGCATTGATAGGOvergo seq fw:TGAAGCCGAGATGGCACGGACTCA
Reverse primer:CAGCTTCCGAATGTGTTCCOvergo seq rv: TGTGGCTTTATTTTTCTGAGTCCG
Tm:59.0Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS471Mimulus unigene:MgU1362Phytome id:mgut636
 Arabidopsis homolog:At1g78690
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 70.70cM
M. guttatus IM62_x_DUN RILs(2009)11 81.85cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 63.15cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATGGATGAGGCTCTTGACCOvergo seq fw:AACTGTAGCCAATCTGCTCAACAC
Reverse primer:GCAATGAGACTTGCAGTTCCOvergo seq rv: GTTGTAGACGGTGGTGGTGTTGAG
Tm:60.6Tm:65.40
IM62 lengthBAC contig(s):MgFPC1684, MlFPC1045, MlFPC1262, MlFPC498, MlFPC532, MlFPC658, MlFPC715
    
MgSTS472Mimulus unigene:MgU1363Phytome id:mgut637
 Arabidopsis homolog:At5g66190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 120.30cM

Set:A
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGACGGGATAGACAAGAATGGOvergo seq fw:ACCATACGTCGGCAGATGCCTTCT
Reverse primer:CCTTTAACTGTTTCCCCTTGGOvergo seq rv: CGTGATTTTGGTGTTGAGAAGGCA
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):MlFPC133, MlFPC312
    
MgSTS473Mimulus unigene:MgU1368Phytome id:mgut642
 Arabidopsis homolog:At1g01090
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 40.29cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAAGTCCAGCTCTTCTCTCTCCOvergo seq fw:
Reverse primer:TTGCCTCGGTAGTACATTTGGOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS474Mimulus unigene:MgU1369Phytome id:mgut643
 Arabidopsis homolog:At1g44170
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 30.10cM
M. guttatus Irn Mtn Combined(2009)3 13.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 25.79cM
M. lewisii x M. cardinalis(2009)2+4 35.90cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCGTCAGCATGCAAGTTAGCOvergo seq fw:CGGCAAAACCAGAGATTTGGAGTG
Reverse primer:CAATACGACGCCCAAAGGOvergo seq rv: CAACTGTGAAACCCTCCACTCCAA
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MlFPC1107, MlFPC686, MlFPC862
    
MgSTS475Mimulus unigene:MgU1370Phytome id:mgut644
 Arabidopsis homolog:At4g35090
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 15.01cM
M. guttatus IM62_x_DUN RILs(2009)14 132.69cM

Set:C / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCCAGGAGTTCAGACACCOvergo seq fw:CCACGAACTCTGGAGCTCCAGTCT
Reverse primer:CCCACCAAATCAAAGTTTCCOvergo seq rv: GAGTTGTTATTGTTCCAGACTGGA
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC581, MlFPC210, MlFPC397, MlFPC410, MlFPC626
    
MgSTS476Mimulus unigene:MgU1375Phytome id:mgut649
 Arabidopsis homolog:At5g23250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGCCATTATGGAATCATTGGOvergo seq fw:
Reverse primer:CGATTAGCCGGGTTTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS477Mimulus unigene:MgU1391Phytome id:
 Arabidopsis homolog:At2g18740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 56.10cM
M. guttatus Irn Mtn Combined(2009)4 77.41cM
M. guttatus IM62_x_DUN RILs(2009)4 46.54cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 39.78cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATCCTTCTGCTCGAAAAGCOvergo seq fw:CTCCTCTGCCTCGTCCAAAACCAA
Reverse primer:CCAGAGGATTATGACCCAACCOvergo seq rv: CGACGAGTACATGAATTTGGTTTT
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):MlFPC1009, MlFPC1248, MlFPC785
    
MgSTS478Mimulus unigene:MgU1393Phytome id:mgut655
 Arabidopsis homolog:At2g39260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGCAATACAGCGGGAACGOvergo seq fw:
Reverse primer:TCTATGAATGCCTTCCAGACCOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS479Mimulus unigene:MgU1402Phytome id:mgut659
 Arabidopsis homolog:At1g54100
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 74.86cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 0.00cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCCAAAGTTAATTCCTTGAGCOvergo seq fw:CACCGCCAATTTCAGCTCCGCTGG
Reverse primer:CTTTTGGCGGTGAGAAAGCOvergo seq rv: AACGTAAATATTCCGACCAGCGGA
Tm:57.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS480Mimulus unigene:MgU1413Phytome id:mgut665
 Arabidopsis homolog:At1g16560
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 35.89cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 36.09cM
M. lewisii x M. cardinalis(2009)2+4 19.00cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACACCTCCCCAAACTGCOvergo seq fw:CCACACCACAATCTGCACTACACT
Reverse primer:TATTTGCTTTTGTCGCAACCOvergo seq rv: AGTTAGTGTGGCGATGAGTGTAGT
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS481Mimulus unigene:MgU1436Phytome id:mgut675
 Arabidopsis homolog:At3g18524
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 23.96cM
M. guttatus IM62_x_DUN RILs(2009)9 36.52cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTCCCACTCCTTACACACGOvergo seq fw:TGGTCGCCCGAGTAGTGCAAACTG
Reverse primer:GAAATTCACCCAATCTTGAGCOvergo seq rv: TCGGAAAAACTTGAAGCAGTTTGC
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS482Mimulus unigene:MgU1960Phytome id:mgut811
 Arabidopsis homolog:At5g16880
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 124.85cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGAGGTTGCAGCTGAGAGGOvergo seq fw:GGGGAGAGTCCTCAGATGAGTTGC
Reverse primer:GCCAGACTCTCATCATCACGOvergo seq rv: TAAACAGGCAAATAGCGCAACTCA
Tm:61.3Tm:65.40
IM62 lengthBAC contig(s):MgFPC2792, MlFPC1385
    
MgSTS483Mimulus unigene:MgU1968Phytome id:mgut816
 Arabidopsis homolog:At2g43360
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 9.63cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGAATAAAGATGCCGTTCTCGOvergo seq fw:TAAGGACATCTACGATTCCCCTGT
Reverse primer:ACCCATACAGAAGCGAGTGCOvergo seq rv: GAAGAGGAGATCGAGGACAGGGGA
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC773, MlFPC1110, MlFPC18, MlFPC1884, MlFPC318, MlFPC466
    
MgSTS484Mimulus unigene:MgU1980Phytome id:mgut821
 Arabidopsis homolog:At3g02250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGCGTGAGCTTTCTTAACTCCOvergo seq fw:
Reverse primer:TACTTACGGGGGAAACATGGOvergo seq rv:
Tm:59.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS485Mimulus unigene:MgU1992Phytome id:mgut827
 Arabidopsis homolog:At3g59660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGTATCATGGTCGGATGTACGOvergo seq fw:
Reverse primer:TGGATTTATGAAAGCATGTTGGOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS486Mimulus unigene:MgU1996Phytome id:
 Arabidopsis homolog:At4g19610
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACCTTCCTTGGCTCTCTCCOvergo seq fw:CCGTAATTCCTCTAAGGTTTCACC
Reverse primer:GGGAAACATAGGGGTTTTGCOvergo seq rv: GGAGAGAGCCAAGGAAGGTGAAAC
Tm:61.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS487Mimulus unigene:MgU2041Phytome id:mgut844
 Arabidopsis homolog:At1g14990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGATCAGCTACGCCTACACGOvergo seq fw:
Reverse primer:TTGGTCAGCTCTCGAGTATCCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS490Mimulus unigene:MgU2107Phytome id:mgut866
 Arabidopsis homolog:At3g18480
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 100.99cM
M. guttatus IM62_x_DUN RILs(2009)13 0.00cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTAGTTCGGACGTTGAATCGOvergo seq fw:
Reverse primer:GAAACCCCAGATCCTTGTACCOvergo seq rv:
Tm:58.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS491Mimulus unigene:MgU2110Phytome id:
 Arabidopsis homolog:At4g14110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 54.70cM
M. guttatus IM62_x_DUN RILs(2009)14 42.97cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 50.01cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCACAGTCCAACCTCTTTGCOvergo seq fw:CTGTCGCAACTTTATGCTTCCTCA
Reverse primer:AAGATACAGCTGTTTTCCTTGGOvergo seq rv: TCGCAAACGATGACTGTGAGGAAG
Tm:60.7Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS492Mimulus unigene:MgU2141Phytome id:mgut876
 Arabidopsis homolog:At1g12840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 69.60cM
M. guttatus Irn Mtn Combined(2009)4 59.34cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 50.01cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACCCTCCTAGCAGTTGTTCCOvergo seq fw:GAGGCGAAATATCCAACAATGTCG
Reverse primer:CTCGTGGAGCTTCTTTGAGGOvergo seq rv: CAGTCTCCTTAAGTGGCGACATTG
Tm:59.6Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS493Mimulus unigene:MgU2156Phytome id:mgut879
 Arabidopsis homolog:At3g20000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTCACAACCGGACAAGTTGCOvergo seq fw:
Reverse primer:CGAAGCTGGCAGTAACATCCOvergo seq rv:
Tm:61.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS494Mimulus unigene:MgU2190Phytome id:mgut888
 Arabidopsis homolog:At3g07370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 35.70cM
M. guttatus Irn Mtn Combined(2009)14 127.77cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 74.06cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTTCTGTGCCCTAATGTTCCOvergo seq fw:GGCGGAGCTACTCAGACAAGACGG
Reverse primer:CTATCGCTCTCCTGCAATCCOvergo seq rv: TTTGAAGTACAAGTTGCCGTCTTG
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS495Mimulus unigene:MgU2211Phytome id:
 Arabidopsis homolog:At3g60810
Genetic markerPhysical marker
Map:Not MappedSet:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTTTCTTCTCCAAAGCTTCCOvergo seq fw:CCCCAAGATTGGGCTTTCGTATTC
Reverse primer:ACCGGGCAAGAAATCTATCGOvergo seq rv: CGACTATGTTCGAGTGGAATACGA
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS496Mimulus unigene:MgU2224Phytome id:
 Arabidopsis homolog:At3g13120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGAAGCTCCTTTAGATTCTTCGOvergo seq fw:
Reverse primer:GCACGAATCTTCGATCTAGGGOvergo seq rv:
Tm:59.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS497Mimulus unigene:MgU2257Phytome id:mgut913
 Arabidopsis homolog:At1g32210
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 50.31cM
M. guttatus IM62_x_DUN RILs(2009)5 63.86cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 55.02cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTCAGTCTCTCCGGTCTGCOvergo seq fw:TCCCATTCAACTCCTTTCTTTCGG
Reverse primer:TGAATTAAAGCAGTGACAACAGCOvergo seq rv: ACACATGAGAGCACCCCCGAAAGA
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS498Mimulus unigene:MgU2264Phytome id:mgut915
 Arabidopsis homolog:At3g10410
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 16.62cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 100.24cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGGACTTGGGTCACCATGCOvergo seq fw:
Reverse primer:ATCGGCTGTGCTATTTCTCGOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS499Mimulus unigene:MgU2270Phytome id:
 Arabidopsis homolog:At3g62840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTGCCGCAATAACAAAAAGCOvergo seq fw:
Reverse primer:TTGCCTTTCCCTGTCTTAGGOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS500Mimulus unigene:MgU2272Phytome id:
 Arabidopsis homolog:At4g02290
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 76.50cM
M. guttatus Irn Mtn Combined(2009)14 82.97cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 65.01cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAAAGACTCTGCTCTTTCAGACGOvergo seq fw:TTGGAGAAAAGACTCTGCTCTTTC
Reverse primer:TCCCCTGCATCATAGTACCCOvergo seq rv: CATTGCGGAGCCGTCTGAAAGAGC
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS501Mimulus unigene:MgU2307Phytome id:mgut928
 Arabidopsis homolog:At5g35460
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 84.64cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 52.59cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGAAACAAGCTGTTCAAACGOvergo seq fw:TGTTCTTGGCTTCGGTGGCTTCTG
Reverse primer:ACCCAAAACAAAGCAGAAGCOvergo seq rv: TGCACCCAAAACAAAGCAGAAGCC
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC204, MgFPC294, MgFPC3127, MgFPC394
    
MgSTS502Mimulus unigene:MgU2317Phytome id:mgut932
 Arabidopsis homolog:At2g18290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AATTGAAACGGCTGTCTTGGOvergo seq fw:
Reverse primer:GGGAAACCTTTGTGAATACGOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS503Mimulus unigene:MgU2347Phytome id:
 Arabidopsis homolog:At4g09010
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)3 0.00cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACGCCTCATAATTGATTTGCOvergo seq fw:CCCAACGAACTCAATTTTGTCAGC
Reverse primer:TGGGTTCAGAAGTACCAACGOvergo seq rv: TTGACCTGATCACCGCGCTGACAA
Tm:57.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS504Mimulus unigene:MgU2350Phytome id:mgut944
 Arabidopsis homolog:At2g31740
Genetic markerPhysical marker
Map:Not MappedSet:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCGAAGGTGGTGATTCAGGOvergo seq fw:GGCCGGAGATGAAGTGGCGCGTGA
Reverse primer:GACGATGGCATCAAAGATCCOvergo seq rv: ATATCAGTAATATCCATCACGCGC
Tm:60.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS505Mimulus unigene:MgU2368Phytome id:mgut951
 Arabidopsis homolog:At5g56530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAACCAGCTTTTGATCATCCOvergo seq fw:
Reverse primer:GCCATTCATATGCCACAGCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS506Mimulus unigene:MgU2381Phytome id:
 Arabidopsis homolog:At3g28710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCTTTGAGGCTGACAGAAGGOvergo seq fw:
Reverse primer:TACAACTTCCTACGATCATCTCGOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS508Mimulus unigene:MgU2386Phytome id:mgut959
 Arabidopsis homolog:At2g38130
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 101.17cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTGGCCACATCTCTCTTTCCOvergo seq fw:CAGGAGCTGAGCGAACCCTATTCC
Reverse primer:GTTGAGAACAACGAGCATGGOvergo seq rv: ATCTGTAGGTGAAGATGGAATAGG
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):MlFPC54, MlFPC617, MlFPC63, MlFPC693, MlFPC988
    
MgSTS509Mimulus unigene:MgU2403Phytome id:mgut967
 Arabidopsis homolog:At2g07050
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 63.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 87.67cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCCATTTTCAACTGCTGACCOvergo seq fw:GCTTTGCTGTTGGGTGGAAGATCC
Reverse primer:AACCGCTTAGCATCCAGAGGOvergo seq rv: GAAAGCTTCTGAATTTGGATCTTC
Tm:60.6Tm:63.35
IM62 lengthBAC contig(s):MgFPC24, MgFPC3005, MlFPC1036, MlFPC1063, MlFPC737
    
MgSTS510Mimulus unigene:MgU2404Phytome id:mgut968
 Arabidopsis homolog:At4g35420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)12 13.30cM

Set:
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:AACATATCCCATTCTTCCATGCOvergo seq fw:
Reverse primer:CTTCCATCATTTGTGGTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS511Mimulus unigene:MgU2405Phytome id:mgut969
 Arabidopsis homolog:At1g51130
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 6.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 0.00cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGAATCGGAAGTCCTTTGCOvergo seq fw:ATAAAAGATGGGCGTGCCGAGATA
Reverse primer:CTCTAGGCGCATTCCTTGGOvergo seq rv: CAGCCTCATCCACTGATATCTCGG
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC2926, MgFPC853, MlFPC1026, MlFPC462, MlFPC638
    
MgSTS512Mimulus unigene:MgU2407Phytome id:
 Arabidopsis homolog:At5g30510
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 72.65cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 67.47cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGTGCATTCATAGACATTGGOvergo seq fw:GTGTCTCCGATATTGCTACAGTTC
Reverse primer:GTCCTCTCTCACGGTCATGGOvergo seq rv: GTATCACCGGGCTGAAGAACTGTA
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):MlFPC1278, MlFPC258, MlFPC65
    
MgSTS513Mimulus unigene:MgU2415Phytome id:mgut974
 Arabidopsis homolog:At3g20050
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 95.10cM
M. guttatus Irn Mtn Combined(2009)2 84.55cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 66.61cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGACCATCATCTTTGACAAGCOvergo seq fw:CGCCTTGACCATCATCTTTGACAA
Reverse primer:GAAGCAGGAGTCATCGAACCOvergo seq rv: GACGACATGATCAAGCTTGTCAAA
Tm:60.1Tm:64.38
IM62 lengthBAC contig(s):MlFPC1, MlFPC1486, MlFPC1880, MlFPC232, MlFPC353, MlFPC626, MlFPC64
    
MgSTS514Mimulus unigene:MgU2419Phytome id:mgut976
 Arabidopsis homolog:At5g56360
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 12.61cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCGTAAGTTCGTTTTTCAAGCOvergo seq fw:
Reverse primer:TGGTGATAAGTGTTGGAACGOvergo seq rv:
Tm:58.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS515Mimulus unigene:MgU2421Phytome id:
 Arabidopsis homolog:At4g02480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GAACAGGATGCTGCTCTTGCOvergo seq fw:
Reverse primer:TTACTGACTCCGACGAAACGOvergo seq rv:
Tm:61.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS516Mimulus unigene:MgU2449Phytome id:mgut987
 Arabidopsis homolog:At2g29940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:TTACGGAATGATGGTTGTCGOvergo seq fw:
Reverse primer:TATCCACCATCCAGGAATGCOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS517Mimulus unigene:MgU2454Phytome id:mgut991
 Arabidopsis homolog:At5g43745
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCAATGGCAATTTCTCTACGOvergo seq fw:TCGAGACTCAGAGGCTCCAACTTC
Reverse primer:TGCAGAGGGAGATGAAATATACGOvergo seq rv: TTATAAACCCGATTCCGAAGTTGG
Tm:58.2Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS518Mimulus unigene:MgU2488Phytome id:mgut1007
 Arabidopsis homolog:At3g54210
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGCTGTTTCCCTCTTCGOvergo seq fw:
Reverse primer:GCTCCGTAAAAGAGCCTTCCOvergo seq rv:
Tm:61.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS519Mimulus unigene:MgU2500Phytome id:mgut1014
 Arabidopsis homolog:At2g41530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 5.52cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 22.70cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGAATTTCATCGCCAAATCGOvergo seq fw:
Reverse primer:CCAGCTGTCGGACTCTCCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS520Mimulus unigene:MgU2589Phytome id:mgut1044
 Arabidopsis homolog:At5g60450
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 122.80cM
M. guttatus IM62_x_DUN RILs(2009)14 119.56cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 112.58cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCTCATCTTCTCCACTTCCOvergo seq fw:CAAGCCAACGCTCATCTTCTCCAC
Reverse primer:GGAGAGGCTGTTTAGCATGGOvergo seq rv: ATACACGCAAGAGGAAGTGGAGAA
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC2049, MgFPC404, MlFPC1390, MlFPC1565, MlFPC207, MlFPC506, MlFPC84
    
MgSTS521Mimulus unigene:MgU2611Phytome id:mgut1054
 Arabidopsis homolog:At1g31870
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)10 44.68cM

Set:C / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:overgo designed but not yet included in a set
Forward primer:AAGACACTGGGATGGTGTCGOvergo seq fw:GGGTTGGCTCAGAAACGCGAAGCT
Reverse primer:AGAAACGGACCACAGATATGCOvergo seq rv: CTTGAAATCTAGCTTCAGCTTCGC
Tm:61.0Tm:65.40
IM62 lengthBAC contig(s):MlFPC1878, MlFPC261, MlFPC58, MlFPC771
    
MgSTS522Mimulus unigene:MgU2616Phytome id:mgut1057
 Arabidopsis homolog:At3g05560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGCAAGATTACCGTCACTGCOvergo seq fw:
Reverse primer:TTGTTGGAAGCAATCACACGOvergo seq rv:
Tm:58.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS523Mimulus unigene:MgU2633Phytome id:mgut1061
 Arabidopsis homolog:At1g73060
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 45.65cM

Set:C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAACCCTCAGCAGTTCTTCCOvergo seq fw:TTCCTCCTGCAATCCGAGAACCCT
Reverse primer:TTGGCAAGTGATGTTGAAGCOvergo seq rv: TAAGGAAGAACTGCTGAGGGTTCT
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):MlFPC1203, MlFPC845
    
MgSTS525Mimulus unigene:MgU2652Phytome id:mgut1064
 Arabidopsis homolog:At3g24550
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 36.97cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 34.18cM

Set:C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAGTTGATCACTGGCAAACGOvergo seq fw:TCGATCAACGGCTGAGAAACGAGC
Reverse primer:CGACGCCTAGCTGAGTGGOvergo seq rv: ATCTCGTTCGCATTGTGCTCGTTT
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS526Mimulus unigene:MgU2663Phytome id:mgut1067
 Arabidopsis homolog:At1g30300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 58.88cM
M. guttatus IM62_x_DUN RILs(2009)13 40.27cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 43.68cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCATACGCAAGCTCAACTGGOvergo seq fw:
Reverse primer:GAGGATATGCCCAAAGAGAGCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS527Mimulus unigene:MgU2716Phytome id:mgut1086
 Arabidopsis homolog:At3g22790
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 16.80cM
M. guttatus Irn Mtn Combined(2009)14 148.80cM
M. guttatus IM62_x_DUN RILs(2009)14 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 4.24cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCATTCAGAATCGAGACGOvergo seq fw:CGCTTGTATTCTTGGTGGTGGGAT
Reverse primer:TTGATCATCGATTTCACTTTGCOvergo seq rv: TTGGTGTGTTGTGGCTATCCCACC
Tm:60.5Tm:65.40
IM62 lengthBAC contig(s):MlFPC1, MlFPC123, MlFPC235, MlFPC80
    
MgSTS528Mimulus unigene:MgU2731Phytome id:
 Arabidopsis homolog:At3g12020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCATCCAGGACAACATCACGOvergo seq fw:
Reverse primer:TTCAACGGTCAGCAGTAAGGOvergo seq rv:
Tm:60.5Tm:
IM62 lengthBAC contig(s):