Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (300 - 399) out of 1979 markers

MgSTS323Mimulus unigene:MgU1451Phytome id:
 Arabidopsis homolog:At1g65430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 114.80cM
M. guttatus IM62_x_DUN RILs(2009)6 112.64cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 6.12cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCAGAGAAGGAATTTCAAGGOvergo seq fw:TATGCATGCAACCGTTATGAAGCT
Reverse primer:CTCGCCTTGCTTGTTACTGCOvergo seq rv: CTCCTTCTCGCTTGGCAGCTTCAT
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC2539, MgFPC257, MgFPC830, MlFPC1, MlFPC1242, MlFPC14, MlFPC195, MlFPC501, MlFPC618, MlFPC742
    
MgSTS324Mimulus unigene:MgU1610Phytome id:mgut723
 Arabidopsis homolog:At5g19330
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AAAGAGATGCTAAAGACATAGAGATCCOvergo seq fw:GTTGTCCGTCATGCCCTGGTATTC
Reverse primer:AATTACGAGTCTCGGGTAAAATACGOvergo seq rv: ACGTTGGATAAGCTGAGAATACCA
Tm:59.0Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS325Mimulus unigene:MgU1613Phytome id:mgut724
 Arabidopsis homolog:At5g01430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)4 132.02cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 117.72cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGTTTGACGGGATTTGGOvergo seq fw:GGTTTGACGGGATTTGGTGTCTGC
Reverse primer:TTACAGTCACCCCTGACACGOvergo seq rv: TCCCCAACAGTGAAATGCAGACAC
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS326Mimulus unigene:MgU1620Phytome id:mgut727
 Arabidopsis homolog:At1g16780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 128.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 95.18cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCATTGGCCATTATATCACCOvergo seq fw:GCTGCAGTTGGTCGAACTGCTCAG
Reverse primer:GCGGACATTAACATCGAAGCOvergo seq rv: CTTCTTTAACTACCTCCTGAGCAG
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS327Mimulus unigene:MgU1624Phytome id:
 Arabidopsis homolog:At5g20720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 98.14cM
M. guttatus IM62_x_DUN RILs(2009)12 85.59cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACGGAAGTGGAATTCGAAGGOvergo seq fw:GGCCTGTACTTATCAGATGCCAGC
Reverse primer:GTTTTCGTTTCAGCCTCAGCOvergo seq rv: TTGAGGGCTTCTCTTTGCTGGCAT
Tm:61.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC1888, MgFPC394, MgFPC445
    
MgSTS328Mimulus unigene:MgU1633Phytome id:mgut729
 Arabidopsis homolog:At1g32200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTGCTACAAACGAATGGTATCCOvergo seq fw:
Reverse primer:AGGGGGCATAATTTCATGGOvergo seq rv:
Tm:59.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS329Mimulus unigene:MgU50Phytome id:mgut2020
 Arabidopsis homolog:At5g48300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 24.19cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 77.89cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCCACTCTTGATGAAGTACCCOvergo seq fw:
Reverse primer:GCCATAATCGACAAAAATGCOvergo seq rv:
Tm:58.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS330Mimulus unigene:MgU53Phytome id:mgut2147
 Arabidopsis homolog:At1g11260
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 93.70cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 70.56cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGTCTTATTTTCGGCTACGOvergo seq fw:CAGCCATGGGCGGTCTTATTTTCG
Reverse primer:ATCCATGGCCGTCACTCCOvergo seq rv: ATTCCGATATCGTAGCCGAAAATA
Tm:59.7Tm:65.40
IM62 lengthBAC contig(s):MgFPC720, MlFPC301
    
MgSTS331Mimulus unigene:MgU1670Phytome id:
 Arabidopsis homolog:At2g43950
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 4.73cM
M. guttatus IM62_x_DUN RILs(2009)7 74.29cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCCTGCTTTGAACTTGTAGTCCOvergo seq fw:
Reverse primer:TCAAATGCAGTTTCGTGTGCOvergo seq rv:
Tm:60.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS332Mimulus unigene:MgU1702Phytome id:mgut746
 Arabidopsis homolog:At2g41790
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 11.90cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 26.46cM
M. lewisii x M. cardinalis(2009)3 93.60cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTGGTGTGCAATTCATTATCCOvergo seq fw:GCTCCTAATCCCGTATCTCAGGCT
Reverse primer:AAATTCATCACTGGACATTTCGOvergo seq rv: ACTGAGACGCAAACATAGCCTGAG
Tm:57.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS333Mimulus unigene:MgU1710Phytome id:mgut748
 Arabidopsis homolog:At5g54190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 103.07cM
M. guttatus IM62_x_DUN RILs(2009)8 70.71cM
M. lewisii x M. cardinalis(2009)6 7.00cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTTTCCGAGGAAGAATCTGGOvergo seq fw:GGGTTCGTTTCCGAGGAAGAATCT
Reverse primer:AGCTGGTTCACAAACGAAGCOvergo seq rv: GTGCGAGTCTTTTACCAGATTCTT
Tm:58.7Tm:65.40
IM62 lengthBAC contig(s):MgFPC442, MlFPC1037, MlFPC141, MlFPC154, MlFPC1876, MlFPC197, MlFPC41, MlFPC411, MlFPC670, MlFPC708, MlFPC893, MlFPC91
    
MgSTS334Mimulus unigene:MgU1728Phytome id:
 Arabidopsis homolog:At1g31340
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 11.94cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAGGAGGTATTCCTTCTTTGTCCOvergo seq fw:
Reverse primer:TCACCGGAAAAACCATTACCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS335Mimulus unigene:MgU1106Phytome id:mgut499
 Arabidopsis homolog:At4g33950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATCCGGGATTGAGTATTGGOvergo seq fw:
Reverse primer:ATGCTAGTCGGTGCGTATCCOvergo seq rv:
Tm:57.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS336Mimulus unigene:MgU1732Phytome id:
 Arabidopsis homolog:At5g10730
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)1 39.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 23.06cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCCACATCACACTGTTAGCCOvergo seq fw:TAACATTAACAGGAGGGGTTAATA
Reverse primer:TGCAAAGAAGCTTTGAATCGOvergo seq rv: CCGCTAGTGGGGCCACTATTAACC
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC2237, MgFPC2787, MgFPC928
    
MgSTS337Mimulus unigene:MgU1742Phytome id:
 Arabidopsis homolog:At5g55190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 110.67cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTGCAGCCATATCAATTTGCOvergo seq fw:TCATCATCATCTGGAAGAGGCTGG
Reverse primer:TTTGAGAAGCCTTTCCTGTACCOvergo seq rv: TTGCTCAAGCTGCTAGCCAGCCTC
Tm:59.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS338Mimulus unigene:MgU1744Phytome id:mgut759
 Arabidopsis homolog:At3g25690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAACAGCAAGATCTCGAAGCOvergo seq fw:
Reverse primer:AATTCGGGTCTGTGAAACTGGOvergo seq rv:
Tm:58.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS339Mimulus unigene:MgU1757Phytome id:
 Arabidopsis homolog:At5g59850
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATATCGAGCCTTGGACTGCOvergo seq fw:CGGGAAACGCCAGGTCATGATTAG
Reverse primer:CCTCCGACACTCTTCCTACGOvergo seq rv: AACTTTTGACGAAGGCCTAATCAT
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS340Mimulus unigene:MgU1468Phytome id:mgut684
 Arabidopsis homolog:At5g09590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)2 13.83cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 20.18cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCCATCATGGGCTTTGGOvergo seq fw:CCGCCGCAGGGAATTTTCTTCAGC
Reverse primer:AGAAACGCAAGAGTTTGTGGOvergo seq rv: GAAAGCAGAAATAGGAGCTGAAGA
Tm:62.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC129, MlFPC150, MlFPC1603, MlFPC494
    
MgSTS341Mimulus unigene:MgU1763Phytome id:
 Arabidopsis homolog:At5g35630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 12.00cM
M. guttatus Irn Mtn Combined(2009)14 153.55cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAACACCCGTCTGAACTTCCOvergo seq fw:GGATTGGAGGAACCGGGATTGATG
Reverse primer:TTATTACCACCGCGAAATGGOvergo seq rv: CTCGATTTGCTACGAACATCAATC
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):MgFPC478, MlFPC126, MlFPC466, MlFPC673, MlFPC71
    
MgSTS342Mimulus unigene:MgU1765Phytome id:
 Arabidopsis homolog:At3g60245
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 64.88cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGAAGTGAGTCAGCACAGCOvergo seq fw:TGAGTCAGCACAGCAAGTACTTCT
Reverse primer:CACTTTGCCACAATCCTTGCOvergo seq rv: TTTCCGCAGAACTCGCAGAAGTAC
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC2026, MgFPC233, MgFPC278, MgFPC337, MgFPC499, MgFPC609, MlFPC12, MlFPC1312, MlFPC1908, MlFPC21, MlFPC613, MlFPC727, MlFPC789
    
MgSTS343Mimulus unigene:MgU1766Phytome id:
 Arabidopsis homolog:At4g35000
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 0.00cM
M. guttatus IM62_x_DUN RILs(2009)2 0.00cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TAATAGCGGCTTGAAAATCGOvergo seq fw:
Reverse primer:TCGGGCATTTAGACTTCACCOvergo seq rv:
Tm:58.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS344Mimulus unigene:MgU1774Phytome id:mgut765
 Arabidopsis homolog:At2g05990
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 9.20cM
M. guttatus IM62_x_DUN RILs(2009)11 7.39cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCAACTCCAACTCCCATTGCOvergo seq fw:ATGCCAACGGAGATGCCAGAAAAG
Reverse primer:TGGAGAATGCACCCTTGCOvergo seq rv: GTTGGAAATGCTGCTGCTTTTCTG
Tm:61.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC1521, MgFPC2894, MlFPC1765
    
MgSTS345Mimulus unigene:MgU1779Phytome id:
 Arabidopsis homolog:At1g36240
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCTCTTGTGATGAAGAGTGGOvergo seq fw:CTTGGTTACAAGACTGTTCTCAAA
Reverse primer:GATCTCGGACTTCCTCAACGOvergo seq rv: TGGAGCTCCTGAGGGTTTTGAGAA
Tm:59.9Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS346Mimulus unigene:MgU1785Phytome id:
 Arabidopsis homolog:At4g30620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTGCCTTCTTCACAGTCTCGOvergo seq fw:
Reverse primer:CGTATCTGCGGTTTATTTGGOvergo seq rv:
Tm:58.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS347Mimulus unigene:MgU1797Phytome id:mgut771
 Arabidopsis homolog:At1g02870
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 6.40cM
M. guttatus IM62_x_DUN RILs(2009)4 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACGGCTTCATGTTTCTCGOvergo seq fw:ACAAGTCACTCGGCGTCGTTTCGA
Reverse primer:GCACAGTTTCTCGAGTGTTGCOvergo seq rv: CCGAGAAAATTAGGGTTCGAAACG
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):MlFPC1560, MlFPC251
    
MgSTS348Mimulus unigene:MgU1804Phytome id:mgut773
 Arabidopsis homolog:At1g36370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 57.30cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 49.32cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAAAAGATTTCGGCAGTTTCCOvergo seq fw:ACCTCGAAATCAGACTCGAGACAC
Reverse primer:TTGAGAAGGTCTGTGAGTTATGCOvergo seq rv: CAATGACATCGAGAGGGTGTCTCG
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS349Mimulus unigene:MgU1810Phytome id:mgut775
 Arabidopsis homolog:At2g40060
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 36.83cM
M. guttatus IM62_x_DUN RILs(2009)6 50.01cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 66.70cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCTTGTGAAACCAACATAGCOvergo seq fw:TTTCTCGTCGGTTACTAATGATGA
Reverse primer:GCATGGAACTTCTCGTGTCCOvergo seq rv: CGGAAGAAACGGGCCGTCATCATT
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS350Mimulus unigene:MgU65Phytome id:mgut2646
 Arabidopsis homolog:At4g16143
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 62.49cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 89.08cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGGGCTCTCACAAATATTGCOvergo seq fw:ATAACATGGTTGAGATTCGCAAGA
Reverse primer:ACCAGCTACATTTCCCAACGOvergo seq rv: CTCTCTTCGCGGCGGTTCTTGCGA
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS351Mimulus unigene:MgU1816Phytome id:mgut776
 Arabidopsis homolog:At5g08170
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 53.20cM
M. guttatus Irn Mtn Combined(2009)10 42.86cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 65.29cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAAAAGGTTCCGAGGTTTCCOvergo seq fw:GTGGAGGAAGGTTGTTACGAAGAT
Reverse primer:TTCGGTTGTAAGGCAAGTCCOvergo seq rv: GTAGGTCGAGACTCCAATCTTCGT
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS352Mimulus unigene:MgU1824Phytome id:
 Arabidopsis homolog:At1g74060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:GCAAGTAGAGAAGAAAAAGAAGAAGGOvergo seq fw:
Reverse primer:CCAAATAGGACTTGAGGTCTGCOvergo seq rv:
Tm:59.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS353Mimulus unigene:MgU1827Phytome id:mgut777
 Arabidopsis homolog:At3g52590
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTTCGTGAAAACCCTCACCOvergo seq fw:CGAGGTCGAATCGAGCGACACCAT
Reverse primer:CCATCTTCAAGCTGCTTTCCOvergo seq rv: AGCTTTGACATTGTCAATGGTGTC
Tm:60.1Tm:65.40
IM62 length0BAC contig(s):
    
MgSTS354Mimulus unigene:MgU1828Phytome id:
 Arabidopsis homolog:At2g40430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 77.39cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 74.54cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGAAAAAGTGCTCCGATGCOvergo seq fw:AAAGTCCACAAAAGATGCTCTTTC
Reverse primer:CGACGCCAGAATCAAGTGCOvergo seq rv: GGCCAAAGAACCGCCGGAAAGAGC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC1821, MgFPC2454, MgFPC636, MlFPC590, MlFPC707, MlFPC88
    
MgSTS355Mimulus unigene:MgU1829Phytome id:
 Arabidopsis homolog:At3g52580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 73.18cM

Set:D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTCTGGTGCTGTCAGTTGGOvergo seq fw:CACCCTTTCTTCTGGTGCTGTCAG
Reverse primer:ATTAAGCTCCGCGCTACTGGOvergo seq rv: GTGACTCCAATTCCAACTGACAGC
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC1581, MgFPC213, MgFPC2369, MgFPC528, MgFPC536, MgFPC971, MlFPC386, MlFPC58
    
MgSTS356Mimulus unigene:MgU1830Phytome id:
 Arabidopsis homolog:At3g01280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCCAGCGAAGTTTACAACGOvergo seq fw:
Reverse primer:GCTCCTGATCAAAGGTCTGGOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS357Mimulus unigene:MgU1835Phytome id:
 Arabidopsis homolog:At5g03455
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAACTTTCGAGCACATTTGGOvergo seq fw:
Reverse primer:GCAAGGATACTCTCGTTTTCCOvergo seq rv:
Tm:60.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS358Mimulus unigene:MgU1840Phytome id:
 Arabidopsis homolog:At2g47610
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 89.90cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 77.12cM
M. lewisii x M. cardinalis(2009)1 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCATCCTCTGAGCAGCTTCCOvergo seq fw:CACCGCCTCCCCATTTCTTCCTCG
Reverse primer:AATTGTCCACCAAAAGACAGCOvergo seq rv: GACAAATATGATGAGACGAGGAAG
Tm:60.6Tm:65.40
IM62 lengthBAC contig(s):MlFPC114, MlFPC154, MlFPC1909, MlFPC363, MlFPC594, MlFPC710
    
MgSTS360Mimulus unigene:MgU1853Phytome id:mgut784
 Arabidopsis homolog:At1g13160
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 56.30cM
M. guttatus Irn Mtn Combined(2009)11 13.20cM
M. guttatus IM62_x_DUN RILs(2009)11 66.88cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGATGCCAGGTCAGTGTTAGCOvergo seq fw:CGAGCGCAAGTGATGGCATTCTTT
Reverse primer:TTTTCTCGATTGCTGGAACCOvergo seq rv: TGGAAGTCCTCGTTAGAAAGAATG
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):MlFPC337, MlFPC501, MlFPC514, MlFPC527
    
MgSTS361Mimulus unigene:MgU1854Phytome id:mgut785
 Arabidopsis homolog:At1g55860
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)13 78.94cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTTTTAAGGCACTCCAAGGOvergo seq fw:GCATATGGAGCTCCTGAGAGACTT
Reverse primer:TGGAAGAATACTCGGGAAGGOvergo seq rv: AGGTATGAGCTGATGGAAGTCTCT
Tm:58.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS362Mimulus unigene:MgU1862Phytome id:mgut789
 Arabidopsis homolog:At1g60970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 61.10cM
M. guttatus IM62_x_DUN RILs(2009)4 51.63cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 41.93cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACTGGCCGACAAATAGTGCOvergo seq fw:GCGTGTTGCTGTCAAGTACTATTC
Reverse primer:GAAGCCCTGTAGGACAGTAGCOvergo seq rv: TGTCGGCCAGTCATCTGAATAGTA
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):MgFPC344, MgFPC676, MlFPC1, MlFPC15, MlFPC21, MlFPC23, MlFPC240, MlFPC406, MlFPC545, MlFPC80, MlFPC841, MlFPC864
    
MgSTS363Mimulus unigene:MgU1868Phytome id:
 Arabidopsis homolog:At2g39990
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)6 56.26cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATGGAAACCTCAATGGAACGOvergo seq fw:ATTCCATTGGACCTACGCATGGTT
Reverse primer:ACAGTTTGGGAAGGGATGCOvergo seq rv: CAATTCGCTCTGCCTCAACCATGC
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS364Mimulus unigene:MgU1871Phytome id:
 Arabidopsis homolog:At2g43710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGAAGAGAATAGGCATGGOvergo seq fw:
Reverse primer:CTGGGTCGATCTCGAATAGCOvergo seq rv:
Tm:57.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS365Mimulus unigene:MgU1886Phytome id:
 Arabidopsis homolog:At1g55090
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTGAACTCGAGCCAATACGOvergo seq fw:CCACAGCTGAACTCGAGCCAATAC
Reverse primer:GGATACAGGCCCACATCGOvergo seq rv: TGGCTGTAATTGGATCGTATTGGC
Tm:60.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS366Mimulus unigene:MgU1887Phytome id:
 Arabidopsis homolog:At3g27300
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGCAGGGAAAGCTTTAGGOvergo seq fw:GGTCCCAGACAACTCAAACACTCC
Reverse primer:CATGTAAATGGCCTCTGAAGGOvergo seq rv: CACTGATGCAAAAGTGGGAGTGTT
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS367Mimulus unigene:MgU69Phytome id:
 Arabidopsis homolog:At1g23740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 78.61cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTGTCACTGCACCCGTTAGCOvergo seq fw:
Reverse primer:AAGACCTACCCGAGAAATTCGOvergo seq rv:
Tm:61.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS368Mimulus unigene:MgU404Phytome id:mgut1635
 Arabidopsis homolog:At4g37760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 48.47cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 52.42cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGTCGGTGAACTCCTACAGCOvergo seq fw:TGCTGTACACCTTGCGGAGGAGGA
Reverse primer:AGGGCATATCCGAAAACTCGOvergo seq rv: TTCGTTTTCCCAATTGTCCTCCTC
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS369Mimulus unigene:MgU405Phytome id:
 Arabidopsis homolog:At5g13930
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGATCTTAAGGAAAAATTTCAGCOvergo seq fw:AAGCTGCACAGAAGGCCATAAAAG
Reverse primer:AGAGAAGGTGCCATGTACGCOvergo seq rv: TTCGGCTGACCCCATTCTTTTATG
Tm:58.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS370Mimulus unigene:MgU407Phytome id:
 Arabidopsis homolog:At1g62660
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 37.91cM
M. guttatus IM62_x_DUN RILs(2009)6 37.32cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 79.72cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTGCTAAAGGGGCTAACGOvergo seq fw:TATGCGATTGGAACGTACGACCCG
Reverse primer:TTTTCACCATGAAGCACAGGOvergo seq rv: TCCACTTGTTCCCAATCGGGTCGT
Tm:59.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS371Mimulus unigene:MgU416Phytome id:
 Arabidopsis homolog:At1g80530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 50.25cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTAAAAATGTTCGAGGGATGGOvergo seq fw:GCTGCTTAGGGCGGAGGCGTATAG
Reverse primer:TGAGCTTGTTCAGCTTTTGCOvergo seq rv: GATCCTAATATTTCTCCTATACGC
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS372Mimulus unigene:MgU418Phytome id:
 Arabidopsis homolog:At2g30020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GGTTTATTGTAAAAGAGGGAGAGGOvergo seq fw:
Reverse primer:AAATTCAGCTGCCTTTGTGCOvergo seq rv:
Tm:58.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS373Mimulus unigene:MgU424Phytome id:mgut1693
 Arabidopsis homolog:At4g35100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCCGTCATCTTCAACAACGOvergo seq fw:
Reverse primer:CTCCTGAAGGAACCCAAAGCOvergo seq rv:
Tm:60.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS374Mimulus unigene:MgU425Phytome id:
 Arabidopsis homolog:At2g28000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAGGCTGGAATTGACAAGCOvergo seq fw:
Reverse primer:CCATCGTTAACCACCTTTGGOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS375Mimulus unigene:MgU430Phytome id:mgut1709
 Arabidopsis homolog:At3g23530
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACGTCCTGATGAACTTCTCGOvergo seq fw:GTATGGATCACCAAATGCAGCAAC
Reverse primer:GGAGCACGTTGAAGACATCGOvergo seq rv: CAGTCGACCGGGAAATGTTGCTGC
Tm:60.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS376Mimulus unigene:MgU363Phytome id:
 Arabidopsis homolog:At5g19140
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 56.70cM
M. guttatus IM62_x_DUN RILs(2009)7 18.21cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 44.74cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TACAAAACGCTTCGTGATCGOvergo seq fw:TCCAGCTGGCGTATACTCACTGCA
Reverse primer:CAGTGATTCCCCAATAAAGAGGOvergo seq rv: TGTAAAGAAGACTGGCTGCAGTGA
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS377Mimulus unigene:MgU1425Phytome id:
 Arabidopsis homolog:At1g32050
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 43.29cM
M. guttatus IM62_x_DUN RILs(2009)1 26.65cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTTATTCCCCCTGAAATATGCOvergo seq fw:
Reverse primer:CGGACCATGTTTTGGTTGGOvergo seq rv:
Tm:57.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS378Mimulus unigene:MgU2865Phytome id:
 Arabidopsis homolog:At2g21160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GGTACTCTGGTATGGGTGTTGGOvergo seq fw:
Reverse primer:CGTCATCTCAAGCTTCTTTCCOvergo seq rv:
Tm:60.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS379Mimulus unigene:MgU1892Phytome id:
 Arabidopsis homolog:At3g47370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCACCACCAGGAAGTCTCCOvergo seq fw:
Reverse primer:TGTGAACCCTCATCTCAAACCOvergo seq rv:
Tm:59.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS380Mimulus unigene:MgU1900Phytome id:
 Arabidopsis homolog:At1g67430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)11 62.23cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACGGTGACGACATATAGGGOvergo seq fw:GGCACGGTAAGTTCTTCGTCTTTG
Reverse primer:AAAGGATTGGATGTCGATGCOvergo seq rv: CAATCAGGCCCAAAAGCAAAGACG
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS381Mimulus unigene:MgU840Phytome id:
 Arabidopsis homolog:At2g20760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 59.13cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 69.62cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAGACCAACAAAACCAACAACCOvergo seq fw:TGACATCAGCAACGATTCCGAGGG
Reverse primer:TGGAACGAGCTCTGCTATGGOvergo seq rv: GTCGGAGCTGAATATTCCCTCGGA
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS382Mimulus unigene:MgU1904Phytome id:mgut798
 Arabidopsis homolog:At3g25520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 142.68cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATTCGTGCTGATCCAACTCCOvergo seq fw:
Reverse primer:GCTCAATCAGCTTGTTCTTCCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS383Mimulus unigene:MgU1905Phytome id:
 Arabidopsis homolog:At5g02960
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 63.60cM
M. guttatus Irn Mtn Combined(2009)10 88.80cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGAACGGCAAGAAGATTGCOvergo seq fw:AAATCTCACCTTGGAAACGAGTGG
Reverse primer:TATCTCCCACAGCGTGTCCOvergo seq rv: CAGCAAACGGCTTCTGCCACTCGT
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC33, MgFPC478, MlFPC1737, MlFPC797
    
MgSTS384Mimulus unigene:MgU1914Phytome id:mgut801
 Arabidopsis homolog:At1g78630
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTAAACAACGCTCTTCCAAGGOvergo seq fw:GTGTGGGTGATCGGGACCCGTGTA
Reverse primer:AATTCCCGAAAGAATTGTCGOvergo seq rv: TAACCATCTTAAGGTTTACACGGG
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS385Mimulus unigene:MgU1937Phytome id:
 Arabidopsis homolog:At1g67430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 100.60cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCATGGTGATGACATGTACGOvergo seq fw:GCGCCTTTGCTTCTGAGCCTGGTT
Reverse primer:AAAGGTTTGGATGTGGATGCOvergo seq rv: TTCTCACATTCAGGTTAACCAGGC
Tm:58.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC195, MgFPC2257, MgFPC253, MgFPC254, MgFPC344, MlFPC998
    
MgSTS386Mimulus unigene:MgU1938Phytome id:
 Arabidopsis homolog:At1g23740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)12 106.98cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCCGAGAAATTTGATGTCGOvergo seq fw:ATCTATTCTTGTTCTTGGTGGAGC
Reverse primer:TTTCTCCGTTCGAAGTGACCOvergo seq rv: AGAGCCAACGCCACCAGCTCCACC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS387Mimulus unigene:MgU1940Phytome id:
 Arabidopsis homolog:At5g20240
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 26.71cM
M. guttatus IM62_x_DUN RILs(2009)1 13.77cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GAGTGGAAATCCCATTTTCGOvergo seq fw:
Reverse primer:TGACAGCATGCAGATTGAGCOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS388Mimulus unigene:MgU1941Phytome id:
 Arabidopsis homolog:At5g20720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 63.60cM
M. guttatus Irn Mtn Combined(2009)10 57.03cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 85.56cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACAGTGGCTTCCTCTTGCOvergo seq fw:AGTACAAAACGGTATTCCCAGGAG
Reverse primer:CAAGGATAAGCCTTCAATCGOvergo seq rv: AAGCCACTGTCGGTTGCTCCTGGG
Tm:58.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC478, MgFPC816, MlFPC149, MlFPC1565, MlFPC1897, MlFPC207, MlFPC554
    
MgSTS389Mimulus unigene:MgU1944Phytome id:
 Arabidopsis homolog:At4g30800
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACCTCACTGTTTTGGACAGGOvergo seq fw:GAGCGGAAGAAGAGCCAGCTGGTG
Reverse primer:ATGCTTCCGTGTGAAAGAGGOvergo seq rv: AATGTTCTTAAGGTGTCACCAGCT
Tm:59.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS391Mimulus unigene:MgU451Phytome id:
 Arabidopsis homolog:At1g72160
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 3.06cM
M. guttatus IM62_x_DUN RILs(2009)3 60.49cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCTTAGTTGCGGGTTTAACGOvergo seq fw:
Reverse primer:CATCGAAGACTGCCGATACCOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS392Mimulus unigene:MgU452Phytome id:
 Arabidopsis homolog:At5g40770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AACTTCATTGCCGATTGAGGOvergo seq fw:
Reverse primer:TGAATCTAACTCTGCGTGTGCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS393Mimulus unigene:MgU455Phytome id:
 Arabidopsis homolog:At4g38970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 151.63cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGTTCGGAATGCTCACTACCOvergo seq fw:
Reverse primer:GATCGAACGACGAATCTTGGOvergo seq rv:
Tm:60.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS394Mimulus unigene:MgU458Phytome id:
 Arabidopsis homolog:At5g67380
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTGATCCCTAACGATGTCCOvergo seq fw:CCGTGTCCTGCTACTTTCGGCAGC
Reverse primer:AATGTGAACACCAACGAACGOvergo seq rv: TTTCTTACAAGTCAGAGCTGCCGA
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS395Mimulus unigene:MgU459Phytome id:mgut1827
 Arabidopsis homolog:At5g64570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGGTCATGTTGACCTTTTCCOvergo seq fw:
Reverse primer:CATTTTGTGGGTTGGTTTCCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS396Mimulus unigene:MgU461Phytome id:
 Arabidopsis homolog:At1g59640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATGTCCGAGCGAGAAGAGGOvergo seq fw:
Reverse primer:CCTGGCGTTGTAATGATTGGOvergo seq rv:
Tm:60.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS397Mimulus unigene:MgU465Phytome id:
 Arabidopsis homolog:At1g64390
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTGTTCAGACACTGGTTGCOvergo seq fw:TGGAGGGGTAATTCCGGCCTCAAC
Reverse primer:CGAGCACATGAAAAACTCTGCOvergo seq rv: CGTTTAATTTTCCGTCGTTGAGGC
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS398Mimulus unigene:MgU577Phytome id:mgut2333
 Arabidopsis homolog:At3g23940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 23.90cM

Set:A / D2 / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATCCGTCACACATCCATTCGOvergo seq fw:CATCCGTCACACATCCATTCGAGG
Reverse primer:TGAATGAGCGCAGAAAGAGGOvergo seq rv: AAGAATGTACTTTCGGCCTCGAAT
Tm:61.8Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS399Mimulus unigene:MgU615Phytome id:
 Arabidopsis homolog:At3g13490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGTTCGTCAACAGCATCACGOvergo seq fw:
Reverse primer:AATGCCTCCTGCATCTGGOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS400Mimulus unigene:MgU631Phytome id:mgut2543
 Arabidopsis homolog:At1g21750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCGTACTGCAACAGGTTTCCOvergo seq fw:
Reverse primer:GATGCCGATGTCCTAATCGOvergo seq rv:
Tm:58.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS401Mimulus unigene:MgU634Phytome id:mgut2563
 Arabidopsis homolog:At2g38080
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TAGGGCCTTTCCCATTATCCOvergo seq fw:
Reverse primer:ATGGGTTGCCATTAGATTCCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS402Mimulus unigene:MgU643Phytome id:mgut2604
 Arabidopsis homolog:At5g37510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGTGGTCGTAGTTGAAGTCGOvergo seq fw:
Reverse primer:CAAATGCCGATCTACGTTCCOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS403Mimulus unigene:MgU654Phytome id:mgut2669
 Arabidopsis homolog:At1g65660
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTGGGTCGTCGTGATGGOvergo seq fw:GACCCTCTTCATCCTGTAAGCTTC
Reverse primer:GAGAGGGACGAAAGAAAACGOvergo seq rv: TACACCGGAAGACATGGAAGCTTA
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS404Mimulus unigene:MgU656Phytome id:mgut2681
 Arabidopsis homolog:At1g12940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAACTCCGAAGCAATACCCOvergo seq fw:
Reverse primer:GGTTCCGACAAATTCACAGCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS405Mimulus unigene:MgU657Phytome id:mgut2684
 Arabidopsis homolog:At2g14960
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 97.74cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGAATCGAATCGTCGTCACCOvergo seq fw:
Reverse primer:TCCTTTTCCTTTTTCGACTCCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS406Mimulus unigene:MgU660Phytome id:mgut2706
 Arabidopsis homolog:At5g19750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGGATGATGGGAGTGACTGGOvergo seq fw:
Reverse primer:AAGGGCCGAGGTAACAGCOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS407Mimulus unigene:MgU661Phytome id:mgut2712
 Arabidopsis homolog:At4g31180
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 105.35cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGCTATTCCCACACTACCCOvergo seq fw:TCGAAGGAATTGTTTCTGTTCCGG
Reverse primer:ACTCGAACAAGCTGCTCACCOvergo seq rv: CCAGTGATGGGTTGAGCCGGAACA
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC1152, MgFPC313
    
MgSTS408Mimulus unigene:MgU679Phytome id:mgut2822
 Arabidopsis homolog:At1g60420
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GACGGGTACCCTTTTACTTCCOvergo seq fw:
Reverse primer:CTTCCAGCTCAGCAACAGGOvergo seq rv:
Tm:58.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS409Mimulus unigene:MgU681Phytome id:mgut2833
 Arabidopsis homolog:At2g23350
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TAGCATCGATGACGAAAAGCOvergo seq fw:GACCGCTAGGGAAGCCGTCGACAA
Reverse primer:AAATGCAACGAATCCAGACCOvergo seq rv: ATTAACCCCTTGAAATTTGTCGAC
Tm:59.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS410Mimulus unigene:MgU682Phytome id:mgut2839
 Arabidopsis homolog:At3g43190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCAAAACCACACAGGAAGCOvergo seq fw:
Reverse primer:GAATGAGGCGGTGAATGGOvergo seq rv:
Tm:58.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS411Mimulus unigene:MgU700Phytome id:mgut2939
 Arabidopsis homolog:At5g44635
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTTGCGTCAGAGTGTCTTCGOvergo seq fw:
Reverse primer:CAGAGAAAATGCAGCAGAAGCOvergo seq rv:
Tm:59.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS412Mimulus unigene:MgU728Phytome id:mgut3088
 Arabidopsis homolog:At3g27170
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TAAATCGAACGCTTTCTTCGOvergo seq fw:CGCTTTCTTCGAATCAACTCGCCA
Reverse primer:GATCTGCTTCTCCAGTCTTGCOvergo seq rv: ACCTTTCCTCCAGCTATGGCGAGT
Tm:58.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS413Mimulus unigene:MgU739Phytome id:mgut3156
 Arabidopsis homolog:At5g08560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAATATCAGCTCCTTCGATAGCOvergo seq fw:
Reverse primer:ATTGGAGCAAGCGTTTATCGOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS414Mimulus unigene:MgU747Phytome id:mgut3197
 Arabidopsis homolog:At2g37010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CCAAAGCTGGCAAAGTATTCCOvergo seq fw:
Reverse primer:CATCTGCATGGTTGTTCACCOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS415Mimulus unigene:MgU749Phytome id:mgut3207
 Arabidopsis homolog:At1g04920
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCGGTTCTGAGCAACTCCOvergo seq fw:CCCCGGAAATCATTTCCTCATAAT
Reverse primer:CCACTAGAATGCAAGTCGTTCCOvergo seq rv: GAAACCGGAGACACGGATTATGAG
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS416Mimulus unigene:MgU759Phytome id:mgut3265
 Arabidopsis homolog:At1g12470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 1.15cM

Set:B / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTCCCGAATCATCAGTTCCOvergo seq fw:AAACGGGCATTCACTAGCTATGGC
Reverse primer:AAAGCTTAACAGACGACGAACCOvergo seq rv: ATCGCAGTTGGACGATGCCATAGC
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC1757, MgFPC314
    
MgSTS417Mimulus unigene:MgU773Phytome id:mgut3339
 Arabidopsis homolog:At2g25970
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCGTTGAAAAGAGCTAGGGOvergo seq fw:GAGGCGGTGACGGAGGATTTGATT
Reverse primer:AACCAGAGGATGGAACTTGCOvergo seq rv: CTACCGTAATTGCTTGAATCAAAT
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS418Mimulus unigene:MgU784Phytome id:mgut3399
 Arabidopsis homolog:At3g61490
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TATGGGCATGGAAGAGATGCOvergo seq fw:GGCATGGAAGAGATGCAGCTGGTG
Reverse primer:TGCTGCCACCATACTAAACCOvergo seq rv: AGACTGATGTATCTTCCACCAGCT
Tm:61.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS419Mimulus unigene:MgU786Phytome id:mgut3407
 Arabidopsis homolog:At2g41710
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 137.40cM
M. guttatus Irn Mtn Combined(2009)13 1.16cM
M. guttatus IM62_x_DUN RILs(2009)13 97.26cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 101.50cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTGGCTGCACTTAAATATTGGOvergo seq fw:AGAGAGGATGCACGGCGAAAGAGA
Reverse primer:TGATGCTAGATAATCCTCTCTCGOvergo seq rv: GGCATTTTGCTGATTCTCTCTTTC
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):MgFPC161, MgFPC2837, MgFPC3005, MgFPC7, MlFPC1131, MlFPC734
    
MgSTS420Mimulus unigene:MgU793Phytome id:mgut3445
 Arabidopsis homolog:At2g37340
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)10 40.84cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 89.56cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGACGCCGTATAATAGTGGOvergo seq fw:CCCGTTCTCGGGATTTGGAGCATG
Reverse primer:CCTGGAGCAGGATCTCTACCOvergo seq rv: CCATATCTGCTGAAAACATGCTCC
Tm:58.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS421Mimulus unigene:MgU794Phytome id:mgut3449
 Arabidopsis homolog:At2g46030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTTCACTCAGCTCCTCATCGOvergo seq fw:
Reverse primer:TTGATGATGCGAGACAAAGCOvergo seq rv:
Tm:58.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS422Mimulus unigene:MgU802Phytome id:mgut3495
 Arabidopsis homolog:At1g61800
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCAATGACATGTACGACACCOvergo seq fw:CCGAGAGCATTGACAGGTTGTACG
Reverse primer:TCTTAATTCTTACCCCGTTTGCOvergo seq rv: TCATTTTCCACACACCCGTACAAC
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS423Mimulus unigene:MgU804Phytome id:
 Arabidopsis homolog:At1g33230
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 37.68cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCTGATCTCTCGAACCTCTCGOvergo seq fw:
Reverse primer:ATCTAGCTCGCACCAACTCCOvergo seq rv:
Tm:59.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS424Mimulus unigene:MgU806Phytome id:mgut3514
 Arabidopsis homolog:At5g67030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AACGCCGCCTTTTTATCCOvergo seq fw:
Reverse primer:GACCGATTTGAGGAGTGAGCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):