Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (200 - 299) out of 1979 markers

MgSTS222Mimulus unigene:MgU1524Phytome id:
 Arabidopsis homolog:At5g14780
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGGTACATGCCAAACCAAGCOvergo seq fw:GGTACATGCCAAACCAAGCTATGA
Reverse primer:TTCACTCCAGCAGCATAACGOvergo seq rv: CCCGATATATGAGGGGTCATAGCT
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS223Mimulus unigene:MgU111Phytome id:
 Arabidopsis homolog:At3g59970
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTCAACATTTTTCAAAGGAACGOvergo seq fw:GCCCATTCTTCGTTGAGTTTCTTA
Reverse primer:GTCCCAAAAGCTATATCTCACGOvergo seq rv: AGCCTCGTTCGCGTGATAAGAAAC
Tm:59.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS224Mimulus unigene:MgU513Phytome id:
 Arabidopsis homolog:At4g38970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 150.84cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGTTCGGAATGCTCACTACCOvergo seq fw:GGTTCGGGCTTTGGTTCATTGCGT
Reverse primer:GATCGAACGACGAATCTTGGOvergo seq rv: GCAACCCTAAACTTGAACGCAATG
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS225Mimulus unigene:MgU514Phytome id:
 Arabidopsis homolog:At4g12800
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AATGGATCACCGTTGATTGGOvergo seq fw:CGATGAATGGATCACCGTTGATTG
Reverse primer:TCAAGAGCAACTTCGCTTCCOvergo seq rv: TTCCAAGTGGTCCAGCCAATCAAC
Tm:60.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS226Mimulus unigene:MgU515Phytome id:
 Arabidopsis homolog:At5g25610
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 17.51cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACTGCCAAACTCTCCTATGCOvergo seq fw:GGAATCCATGGTTGATTTCACCAC
Reverse primer:CAGGCTTACCTGGCTTGGOvergo seq rv: TTTCCCCAGCTTGGAGGTGGTGAA
Tm:57.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS227Mimulus unigene:MgU518Phytome id:
 Arabidopsis homolog:At3g01500
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 3.23cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAACATGGTTCCTGCATACGOvergo seq fw:CTCCTCTTCCGAGTCCATCGAGAG
Reverse primer:GGCACTGTGTCCAATCACCOvergo seq rv: GAATCCAGTTTTCAACCTCTCGAT
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC2846, MgFPC2988, MlFPC388
    
MgSTS228Mimulus unigene:MgU1531Phytome id:
 Arabidopsis homolog:At5g38410
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 77.10cM
M. guttatus Irn Mtn Combined(2009)9 22.78cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 58.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCAACAAGCTCATTCCTTGCOvergo seq fw:AAGACTGCTGACATCACCACCATT
Reverse primer:GGGGAGCTGTTGTACTGACGOvergo seq rv: TTCCACCGTTGGTGGCAATGGTGG
Tm:60.9Tm:66.43
IM62 lengthBAC contig(s):
    
MgSTS229Mimulus unigene:MgU505Phytome id:
 Arabidopsis homolog:At5g28540
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 79.40cM
M. guttatus Irn Mtn Combined(2009)6 38.07cM
M. guttatus IM62_x_DUN RILs(2009)6 78.69cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 40.56cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTTGTCTTCTGCCTTCACGOvergo seq fw:CCAGAGGCCTTGTCTTCTGCCTTC
Reverse primer:GGGAAATTCGATCTCACAGGOvergo seq rv: ACGGTATTCTAAACGTGAAGGCAG
Tm:61.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC960, MlFPC1236, MlFPC1238, MlFPC256, MlFPC450, MlFPC830
    
MgSTS230Mimulus unigene:MgU1486Phytome id:
 Arabidopsis homolog:At5g33370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 99.83cM

Set:D2
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCATTGTTGGCTCCATTCCOvergo seq fw:CACCGGTCAATATCTGTTGGACTA
Reverse primer:GCAGATTCCCCTCCTTACGOvergo seq rv: AGGGCCAATCGGATCATAGTCCAA
Tm:61.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS231Mimulus unigene:MgU1474Phytome id:
 Arabidopsis homolog:At1g01610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGAACACCTCGTAGCTCTCCOvergo seq fw:
Reverse primer:CCTCCTTCCCTTACTTCATGCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS232Mimulus unigene:MgU474Phytome id:
 Arabidopsis homolog:At3g23770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 0.00cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ACCCGGTAAAGAGTGCTACGOvergo seq fw:
Reverse primer:GCAACACACTTGGGAACTCGOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS233Mimulus unigene:MgU519Phytome id:
 Arabidopsis homolog:At1g42970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CACTAGAGAAACGGCCTTGGOvergo seq fw:
Reverse primer:CGATGACAACCACTCACTCGOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS234Mimulus unigene:MgU1484Phytome id:
 Arabidopsis homolog:At2g36830
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 115.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 101.90cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGTAACATCACCCTCTTCCOvergo seq fw:TAACATCACCCTCTTCCGCGGTAT
Reverse primer:CCGATTTCTCCCTTCTTGGOvergo seq rv: AGCGATGATGTAGAGGATACCGCG
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS235Mimulus unigene:MgU521Phytome id:mgut2101
 Arabidopsis homolog:At4g18550
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATAACCGGCCACTCACTAGGOvergo seq fw:ACGTACGACACCTTCAACAAGCAG
Reverse primer:ACCCCAACGTTCTTGTAACCOvergo seq rv: CGTATCTCGACATCTGCTGCTTGT
Tm:59.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS236Mimulus unigene:MgU1294Phytome id:
 Arabidopsis homolog:At5g46430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 37.43cM
M. guttatus Irn Mtn Combined(2009)13 52.90cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTCGTGCACAATGTCAAGGOvergo seq fw:AGAGGGTCAAGAAGTTCAAGAGGA
Reverse primer:CCACAATCTCCTTCCTCTTCCOvergo seq rv: AATCGATCGCTCTGGGTCCTCTTG
Tm:60.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC385, MlFPC1099, MlFPC1349, MlFPC279, MlFPC58
    
MgSTS237Mimulus unigene:MgU526Phytome id:
 Arabidopsis homolog:At5g59950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACCTCCGCAAACAGTTCCOvergo seq fw:
Reverse primer:GTCGAGCACAACCACAACCOvergo seq rv:
Tm:60.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS238Mimulus unigene:MgU528Phytome id:
 Arabidopsis homolog:At5g54270
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTTGTCTCCATGGGAAATGGOvergo seq fw:CGCCAATCCTCTCAGAGATGTTGT
Reverse primer:AGGTACGACGGAGTCTGAGCOvergo seq rv: TCCATTTCCCATGGAGACAACATC
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS239Mimulus unigene:MgU532Phytome id:
 Arabidopsis homolog:At3g54340
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 39.62cM
M. guttatus IM62_x_DUN RILs(2009)3 25.31cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 54.66cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTGGGCTACGATCAAATGGOvergo seq fw:GGGCTTTTCAAGAAAGCCCACGAG
Reverse primer:GCTAGTTTCGATTCGGTTGCOvergo seq rv: CACAGAGAACAGAAAGCTCGTGGG
Tm:61.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS240Mimulus unigene:MgU506Phytome id:
 Arabidopsis homolog:At4g10340
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)3 62.93cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAGAATTTTCTTGCCTGATGGOvergo seq fw:TTTCTTGCCTGATGGCCTCTTGGA
Reverse primer:CAGGTTTCTTGCCGAGTCCOvergo seq rv: GGGGATTTCTGATCTGTCCAAGAG
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC20, MgFPC289, MgFPC2920, MgFPC3005, MgFPC627, MgFPC81, MgFPC911, MgFPC969, MlFPC1508, MlFPC185, MlFPC1913, MlFPC662, MlFPC88
    
MgSTS241Mimulus unigene:MgU530Phytome id:mgut2148
 Arabidopsis homolog:At4g39090
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTCAGTTCTCCGATCTCACGOvergo seq fw:
Reverse primer:CCAACACGATCCACAAGTACCOvergo seq rv:
Tm:58.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS242Mimulus unigene:MgU2869Phytome id:
 Arabidopsis homolog:At5g38410
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 22.36cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGCATTGAGTTCGAGTTGGOvergo seq fw:CTCCGCAACAAGCTCATTCCTTGC
Reverse primer:TGCTGACGGTACACAAATCCOvergo seq rv: CCAACTCGAACTCAATGCAAGGAA
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC691, MlFPC1114, MlFPC354
    
MgSTS243Mimulus unigene:MgU541Phytome id:
 Arabidopsis homolog:At5g38430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 22.61cM
M. guttatus IM62_x_DUN RILs(2009)4 72.06cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTACCTTCTCCGCAACAAGCOvergo seq fw:
Reverse primer:GGGGAGCTGTTGTACTGACGOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS244Mimulus unigene:MgU543Phytome id:
 Arabidopsis homolog:At1g32060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGGTGGATATGTTGCTGAGGOvergo seq fw:
Reverse primer:GGCATCAAATTCACCTACGGOvergo seq rv:
Tm:59.5Tm:
IM62 lengthBAC contig(s):
    
MgSTS245Mimulus unigene:MgU544Phytome id:
 Arabidopsis homolog:At1g12900
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)5 60.30cM
M. guttatus IM62_x_DUN RILs(2009)5 52.56cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCCCACCTCCTTAAATACGOvergo seq fw:CATTCGGCAAGAGAGCCAACAGCA
Reverse primer:GGTGATGAGCACCTTCTTCGOvergo seq rv: GAAACGAAGTCTGCATTGCTGTTG
Tm:60.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS246Mimulus unigene:MgU2878Phytome id:
 Arabidopsis homolog:At2g46950
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 38.58cM
M. guttatus IM62_x_DUN RILs(2009)7 33.81cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 35.01cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GGAATAGACGGAGGGTCTCGOvergo seq fw:
Reverse primer:CATCAAGAATGGCAAACTCGOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS247Mimulus unigene:MgU1573Phytome id:
 Arabidopsis homolog:At5g43330
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 145.27cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 7.11cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCCACATGCTCGATATTCCOvergo seq fw:GCTGCCGAGGCACTTAACGGTGTT
Reverse primer:TCAACGACATCGGTTGTAGCOvergo seq rv: CCACCAATTCCATTTTAACACCGT
Tm:58.1Tm:65.40
IM62 lengthBAC contig(s):MlFPC1159, MlFPC521
    
MgSTS248Mimulus unigene:MgU1594Phytome id:mgut715
 Arabidopsis homolog:At5g59850
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TACGTGCTTCTTCGTTGTCCOvergo seq fw:GACTTCCTACGTGCTTCTTCGTTG
Reverse primer:CCCTCGATTCGATGTTGGOvergo seq rv: CTGCTGGAATCATGGACAACGAAG
Tm:58.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS249Mimulus unigene:MgU1582Phytome id:
 Arabidopsis homolog:At3g52590
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 107.15cM
M. guttatus IM62_x_DUN RILs(2009)2 112.12cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTGATTTTTGCTGGGAAGCOvergo seq fw:CGAGGTCGAATCGAGCGACACTAT
Reverse primer:GCCAAAGCCATCAAAGAAGGOvergo seq rv: AGCCTTGACATTGTCAATAGTGTC
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS250Mimulus unigene:MgU1591Phytome id:mgut713
 Arabidopsis homolog:At4g33950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGCGTATCCGTTTGAAGACCOvergo seq fw:
Reverse primer:TTGGACGTTTTCTGGAATGGOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS251Mimulus unigene:MgU1592Phytome id:mgut714
 Arabidopsis homolog:At4g14360
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)7 38.70cM
M. guttatus IM62_x_DUN RILs(2009)7 46.22cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 22.66cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCACAAATCGAGAGGAAGTGGOvergo seq fw:GGGTGTGAATATGGAGGCGTGCAT
Reverse primer:AAAGCAGCAGCAAATGAACCOvergo seq rv: GTCAGAATAAGGCGTAATGCACGC
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MlFPC493, MlFPC626
    
MgSTS252Mimulus unigene:MgU73Phytome id:
 Arabidopsis homolog:At5g09660
Genetic markerPhysical marker
Map:Not MappedSet:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGCTTTCTCCAATCCAACCOvergo seq fw:ATATACCTCTTCAGCACCTGCACG
Reverse primer:CGAGGATTACGAGGAGATGCOvergo seq rv: TAAGGTACGACTCGGTCGTGCAGG
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS253Mimulus unigene:MgU75Phytome id:mgut3215
 Arabidopsis homolog:At3g21070
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCTAAACGACAACGAGTGCOvergo seq fw:
Reverse primer:AGCACAGCATATTCCCTTGCOvergo seq rv:
Tm:60.8Tm:
IM62 lengthBAC contig(s):
    
MgSTS254Mimulus unigene:MgU102Phytome id:mgut158
 Arabidopsis homolog:At3g54960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:AGCCGGAAAGAAAAGAATCGOvergo seq fw:
Reverse primer:GCTCGGAAAACATTTGAGAGGOvergo seq rv:
Tm:60.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS255Mimulus unigene:MgU121Phytome id:mgut570
 Arabidopsis homolog:At2g02720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)5 108.20cM
M. guttatus IM62_x_DUN RILs(2009)5 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 7.50cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCCTTCAGGCATACAATCCOvergo seq fw:ATACAATCCCCACCCCGAGGAATT
Reverse primer:TTGAGTTGCCTCCTTGTGGOvergo seq rv: GTTGAATTCCTCGGTCAATTCCTC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS256Mimulus unigene:MgU126Phytome id:mgut590
 Arabidopsis homolog:At5g64200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGGCAGATGACTTGTTTCCOvergo seq fw:
Reverse primer:CCTTTTGAGCCTCCTCTGGOvergo seq rv:
Tm:59.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS257Mimulus unigene:MgU129Phytome id:
 Arabidopsis homolog:At5g05610
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 102.83cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTTTATGGGCTCTGTGATCCOvergo seq fw:
Reverse primer:CTGGCTCCAAGGTAAAAAGCOvergo seq rv:
Tm:57.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS258Mimulus unigene:MgU131Phytome id:mgut598
 Arabidopsis homolog:At1g75500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGTGGATCTCAGCCTTTTGGOvergo seq fw:
Reverse primer:GGAGGCCCAGTGTTTGTAGCOvergo seq rv:
Tm:59.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS259Mimulus unigene:MgU143Phytome id:
 Arabidopsis homolog:At4g13930
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 6.49cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTGCCCTGTGTAGGAACTCGOvergo seq fw:AAAGTCTTTCTCGACTAATCCTCG
Reverse primer:ATGCTGTGTTTGGTGACAGCOvergo seq rv: GCCCGCCATGACATCTCGAGGATT
Tm:60.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC1804, MgFPC1916, MgFPC2088, MgFPC2230, MgFPC99
    
MgSTS260Mimulus unigene:MgU152Phytome id:
 Arabidopsis homolog:At2g33620
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 89.82cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAAAAGCAGCAAAAGGAAGCOvergo seq fw:GGCAGACCTCGTGGCTCGAGAAAT
Reverse primer:TGAGAACGTACGGTATGAATCCOvergo seq rv: CCTTTTGCTGCTTTTTATTTCTCG
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS261Mimulus unigene:MgU189Phytome id:mgut795
 Arabidopsis homolog:At4g39710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCGCATAGTAAGTGATCTACCGOvergo seq fw:
Reverse primer:GACTTGATTGTTGGCTCTGGOvergo seq rv:
Tm:59.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS262Mimulus unigene:MgU191Phytome id:
 Arabidopsis homolog:At1g80240
Genetic markerPhysical marker
Map:Not MappedSet:A
Guttatus map status:map position determinedPhys map status:
Forward primer:AATCACCGACCGAGAATACGOvergo seq fw:
Reverse primer:ACGGTGTATAGCAGCGATGGOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS263Mimulus unigene:MgU813Phytome id:
 Arabidopsis homolog:At4g29040
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 105.70cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGCTTCAGTGCAGATAGCCOvergo seq fw:CTCCGGTACGCCTTCTTTCTTCTT
Reverse primer:CAAAATTGAAAGCCTTGATCCOvergo seq rv: GGACAAGGTCATGTTCAAGAAGAA
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):MgFPC78, MlFPC1, MlFPC1433, MlFPC1649, MlFPC1839, MlFPC1913, MlFPC322, MlFPC542, MlFPC570
    
MgSTS264Mimulus unigene:MgU204Phytome id:mgut842
 Arabidopsis homolog:At3g54420
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCATGGGTATTGTGTGTTGGOvergo seq fw:
Reverse primer:ACTCGAAGCGGGAGATTGCOvergo seq rv:
Tm:59.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS265Mimulus unigene:MgU217Phytome id:mgut882
 Arabidopsis homolog:At3g19320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GAGGAGGGATTCGATCAGCOvergo seq fw:
Reverse primer:CCAACTCACCGGAAAACTCCOvergo seq rv:
Tm:59.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS266Mimulus unigene:MgU218Phytome id:
 Arabidopsis homolog:At1g77660
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)3 11.28cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 21.11cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGAGGTGTATCGCATTTTCCOvergo seq fw:GTCGATCCGATTCTGAACTGCTTT
Reverse primer:ATGTGGTGAATGGGATGATGGOvergo seq rv: CAGAGTTGCTGCTGTGAAAGCAGT
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS267Mimulus unigene:MgU221Phytome id:
 Arabidopsis homolog:At1g51510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCCTTGGACTCCTCGAACGOvergo seq fw:
Reverse primer:GCAAAGGGTCATTCAAGAGGOvergo seq rv:
Tm:62.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS268Mimulus unigene:MgU22Phytome id:mgut892
 Arabidopsis homolog:At4g02050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GCCTTGTTGCTGCTATTGGOvergo seq fw:
Reverse primer:TCTCATGTGCATGCTTTTGGOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS269Mimulus unigene:MgU235Phytome id:mgut943
 Arabidopsis homolog:At3g15360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:overgo designed but not yet included in a set
Forward primer:GAGTCTGCCAGTTTGAATCGOvergo seq fw:
Reverse primer:GTGGTGGTTCAATCGTCTGCOvergo seq rv:
Tm:58.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS270Mimulus unigene:MgU243Phytome id:mgut980
 Arabidopsis homolog:At3g55770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 34.53cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GACTTCTCGGCTGACTTTGCOvergo seq fw:
Reverse primer:TGGAGGGTGTTCTCTACTGCOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS271Mimulus unigene:MgU246Phytome id:
 Arabidopsis homolog:At4g23840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAGAATGGATGGCATATTTGGOvergo seq fw:
Reverse primer:AGAATCGATATGCCGTTTGCOvergo seq rv:
Tm:60.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS272Mimulus unigene:MgU891Phytome id:
 Arabidopsis homolog:At2g04030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTCTCGGGTTCGTTCTTGCOvergo seq fw:
Reverse primer:AATGAAGGCACAGACACTTGGOvergo seq rv:
Tm:60.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS273Mimulus unigene:MgU267Phytome id:
 Arabidopsis homolog:At3g51980
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)5+8 56.90cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CCCTGTTACTTGTGCCATCCOvergo seq fw:
Reverse primer:GGAAGCTGGAGACTTGATGCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS274Mimulus unigene:MgU282Phytome id:
 Arabidopsis homolog:At1g15820
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 30.25cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 24.89cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGCTCCGCTTCTCTGTACCOvergo seq fw:CAGCTCCGCTTCTCTGTACCATTT
Reverse primer:TCTGCTGCATTGGTTAATGGOvergo seq rv: AGACCCGTCTTTCCTAAAATGGTA
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC3063, MlFPC159, MlFPC805
    
MgSTS275Mimulus unigene:MgU288Phytome id:
 Arabidopsis homolog:At3g20420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 9.14cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CACGACCAACTTCTCTCTCGOvergo seq fw:
Reverse primer:CGTGGACAATGAAATTGAAGGOvergo seq rv:
Tm:58.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS276Mimulus unigene:MgU291Phytome id:mgut1149
 Arabidopsis homolog:At4g27240
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTCGATTCTTACGGAGTGGOvergo seq fw:GGAGTGGTTCTCGGATTTTAACCA
Reverse primer:TCATCACCTCTCCAAACACGOvergo seq rv: AATCTGCCGATCGAGCTGGTTAAA
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS277Mimulus unigene:MgU306Phytome id:
 Arabidopsis homolog:At1g20220
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATAACCGACACATGGGAACCOvergo seq fw:GGATGCGTAGCTACATCACTTACG
Reverse primer:CCATCGAAACTTTCCTTGTGGOvergo seq rv: TGAAGCAAGCTCATGGCGTAAGTG
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS278Mimulus unigene:MgU312Phytome id:mgut1219
 Arabidopsis homolog:At3g02110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 18.69cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACGTCAGCCCTTTGTACACCOvergo seq fw:TTGAAACGCAGCTCTGGGTTTGAA
Reverse primer:ACTCAGTTGTGCCAGTCACCOvergo seq rv: CCACGAAGTGCCTATGTTCAAACC
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC2609, MgFPC2768, MgFPC2795, MlFPC739, MlFPC84
    
MgSTS279Mimulus unigene:MgU313Phytome id:
 Arabidopsis homolog:At5g65700
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 16.96cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCCACTTTGAGCGTGTAGGCOvergo seq fw:
Reverse primer:GCTATCTCCACCACGATTGCOvergo seq rv:
Tm:61.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS280Mimulus unigene:MgU316Phytome id:mgut1229
 Arabidopsis homolog:At1g16860
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CATTATCATGGCGTCGAACCOvergo seq fw:GCGTCGAACCACTCCCATGATACT
Reverse primer:CCTACGCTGGCTTTCTGACCOvergo seq rv: AGAAGGAAGTACAGTGAGTATCAT
Tm:61.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS281Mimulus unigene:MgU320Phytome id:
 Arabidopsis homolog:At5g46250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACCCCATGACTCGTAAATCCOvergo seq fw:
Reverse primer:GAGAAGAATGGGCAGAAAGGOvergo seq rv:
Tm:60.1Tm:
IM62 lengthBAC contig(s):
    
MgSTS282Mimulus unigene:MgU321Phytome id:mgut1250
 Arabidopsis homolog:At1g59900
Genetic markerPhysical marker
Map:Not MappedSet:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCTTTTCAGTGGCTAGATCGOvergo seq fw:GGAAGCACAGCTCTCAATTCTTTT
Reverse primer:GACCCTGGAAGCACATATCGOvergo seq rv: CATTTGGAGCAGACAGAAAAGAAT
Tm:59.5Tm:63.35
IM62 lengthBAC contig(s):
    
MgSTS283Mimulus unigene:MgU1038Phytome id:
 Arabidopsis homolog:At5g14040
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGGTAAATAGACCCAATAGTCCOvergo seq fw:CGAAGAGGCAGTCCTCGGGTAAAT
Reverse primer:ATCACATCCGGCTGATAACCOvergo seq rv: TTGGACTATTGGGTCTATTTACCC
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS284Mimulus unigene:MgU2882Phytome id:
 Arabidopsis homolog:At4g13710
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCAGAACTCTCCAAACTCGOvergo seq fw:GAGGAGTTGCAGAACTCTCCAAAC
Reverse primer:CTCTTCAGGGTCATCAACTGCOvergo seq rv: TTTCCGCCATTGTCGAGTTTGGAG
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS285Mimulus unigene:MgU323Phytome id:mgut1260
 Arabidopsis homolog:At4g11650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ACTCCGTCGTTTTGAACACCOvergo seq fw:
Reverse primer:GACATCTCCGTGATGGAAGGOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS286Mimulus unigene:MgU326Phytome id:
 Arabidopsis homolog:At3g16240
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 64.61cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGATGTTGGCTCCGATGGOvergo seq fw:
Reverse primer:GATGACTCGTTCAGCTTTGGOvergo seq rv:
Tm:59.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS287Mimulus unigene:MgU328Phytome id:
 Arabidopsis homolog:At4g31550
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 30.99cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACAACCCCTCACTGTACTGCOvergo seq fw:GACGGAATATCCGCAACTTTTGAG
Reverse primer:GGCAATTAGCTCAAAAGTTGCOvergo seq rv: GGGTTCCGGCAATTAGCTCAAAAG
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS288Mimulus unigene:MgU335Phytome id:mgut1320
 Arabidopsis homolog:At2g34650
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 73.94cM
M. guttatus IM62_x_DUN RILs(2009)8 39.73cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTCCAGAGCAACCAAAACCOvergo seq fw:CATGTGGAGATATTCCAGAGCAAC
Reverse primer:GGCGATTTGCATTCTCTCCOvergo seq rv: CGCAGCAGAGGTTTTGGTTGCTCT
Tm:59.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS289Mimulus unigene:MgU344Phytome id:
 Arabidopsis homolog:At4g37470
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 11.83cM
M. guttatus IM62_x_DUN RILs(2009)12 9.22cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATCCACCGTGTTCAAAAACCOvergo seq fw:
Reverse primer:CTTGATCGCCGCTTCTCCOvergo seq rv:
Tm:59.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS290Mimulus unigene:MgU345Phytome id:
 Arabidopsis homolog:At1g63440
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 59.86cM
M. guttatus IM62_x_DUN RILs(2009)1 45.47cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTCGTTGATGCCGTCTCCOvergo seq fw:
Reverse primer:GGAAGTTGGGATTGATACCGOvergo seq rv:
Tm:60.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS291Mimulus unigene:MgU351Phytome id:
 Arabidopsis homolog:At4g38460
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGGTGTGGGAGACTATGTGGOvergo seq fw:ATGCATGGTAAATCGTCGTGGATT
Reverse primer:CCAAAGGCGCTAAGAGAGCOvergo seq rv: TCCACGCGGCTTCACTAATCCACG
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS292Mimulus unigene:MgU353Phytome id:mgut1409
 Arabidopsis homolog:At3g04460
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGAAAACGAATCCTGAAACCOvergo seq fw:TCGACTGTTGCCGGCATCAATGTA
Reverse primer:GCGGAAGAGAGAATGTCAGCOvergo seq rv: ACAAGCGTTGTCCAGTTACATTGA
Tm:58.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS293Mimulus unigene:MgU354Phytome id:
 Arabidopsis homolog:At5g01500
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 94.20cM
M. guttatus IM62_x_DUN RILs(2009)10 23.46cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 139.77cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAACAGCCAACCTCAATCGOvergo seq fw:GAGCTTTGCTCTTGTTTCTTGCGA
Reverse primer:CTTTTTCGAGGGAAAGATGGOvergo seq rv: GCATCACAGAGGGGAATCGCAAGA
Tm:60.2Tm:65.40
IM62 lengthBAC contig(s):MlFPC1, MlFPC1461, MlFPC1581, MlFPC1882, MlFPC25, MlFPC432, MlFPC580, MlFPC655
    
MgSTS294Mimulus unigene:MgU1098Phytome id:
 Arabidopsis homolog:At4g15560
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 132.42cM
M. guttatus IM62_x_DUN RILs(2009)8 84.00cM

Set:B / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTATTTATCGGGCAACACCOvergo seq fw:CGCTGCTTCAATCTGATCTTGTGG
Reverse primer:TTGATCACCGTGGAAGAAGGOvergo seq rv: CATCGATCATGGAGCACCACAAGA
Tm:58.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC2779, MlFPC1545, MlFPC464, MlFPC472, MlFPC545, MlFPC995
    
MgSTS295Mimulus unigene:MgU1121Phytome id:mgut509
 Arabidopsis homolog:At1g43170
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 26.95cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATCCACCCATTGGTGTTACGOvergo seq fw:AGTGCGGGAATCCACCCATTGGTG
Reverse primer:TCGTAAGGTCGCTTGTATTGGOvergo seq rv: ACTGAGAAAGACGTAACACCAATG
Tm:60.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC14, MgFPC2436, MgFPC517
    
MgSTS296Mimulus unigene:MgU371Phytome id:
 Arabidopsis homolog:At1g15910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTTCAAATATTTATGGTTGGTTTGCOvergo seq fw:
Reverse primer:CTCTTAATATGCTCACGTGAAACGOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS297Mimulus unigene:MgU1129Phytome id:
 Arabidopsis homolog:At5g13630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 0.00cM
M. guttatus IM62_x_DUN RILs(2009)10 92.19cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 8.36cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAACTGGGGTAAACTGAGGOvergo seq fw:
Reverse primer:GCGAAGACGTTTAGGTACGCOvergo seq rv:
Tm:57.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS298Mimulus unigene:MgU372Phytome id:
 Arabidopsis homolog:At5g50250
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 35.39cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGCAGCATTCACTTTGATCGOvergo seq fw:
Reverse primer:ACATCGCAGCTCCAAAAGGOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS299Mimulus unigene:MgU376Phytome id:mgut1509
 Arabidopsis homolog:At4g37800
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 48.89cM
M. guttatus IM62_x_DUN RILs(2009)8 7.72cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTGATCTTCATGCTCACACGOvergo seq fw:CGCCTCGTTGTTCTTGTAAACCCT
Reverse primer:TAATCACATTCGGCAACTCGOvergo seq rv: GGACGACATACCGATTAGGGTTTA
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS300Mimulus unigene:MgU941Phytome id:mgut4483
 Arabidopsis homolog:At3g23300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 146.90cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GTGATCGCTTCCCAGTGCOvergo seq fw:
Reverse primer:ATCGGCTCCGTTCACAGCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS301Mimulus unigene:MgU377Phytome id:mgut1513
 Arabidopsis homolog:At5g58600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAATCGGAGCACTCTCTTCCOvergo seq fw:
Reverse primer:CCGACGCAGATTATCAGAGGOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS302Mimulus unigene:MgU1145Phytome id:
 Arabidopsis homolog:At5g08690
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCCTGTTCTGAAAGATCATCGOvergo seq fw:CTCAGCCTTGGCAATAACCTCATC
Reverse primer:CAACGATTCTTGAGCCAACCOvergo seq rv: CATGGTTGGAGGAATCGATGAGGT
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS303Mimulus unigene:MgU381Phytome id:mgut1529
 Arabidopsis homolog:At5g65840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 18.39cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GACGCCACTTTTATCATCTGGOvergo seq fw:
Reverse primer:GGCTTGTTTTATGGGATTCGOvergo seq rv:
Tm:59.6Tm:
IM62 lengthBAC contig(s):
    
MgSTS304Mimulus unigene:MgU383Phytome id:mgut1538
 Arabidopsis homolog:At3g03760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTTGCCAAAACAAATCTGCOvergo seq fw:
Reverse primer:TGCGTGTCCACTATCATTGCOvergo seq rv:
Tm:58.3Tm:
IM62 lengthBAC contig(s):
    
MgSTS305Mimulus unigene:MgU384Phytome id:
 Arabidopsis homolog:At5g48300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 71.56cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCATTCTTGTCGATGATGGOvergo seq fw:CCCTCCGCTTCTCTTGCTGCTTCT
Reverse primer:TTGATGGGTGCAGATTATTACGOvergo seq rv: ACAGTGACAATGTTCAAGAAGCAG
Tm:61.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS306Mimulus unigene:MgU385Phytome id:
 Arabidopsis homolog:At2g24190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 88.19cM
M. guttatus IM62_x_DUN RILs(2009)4 35.27cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 29.96cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GAAGCTCCGGCATTATTTACCOvergo seq fw:
Reverse primer:CAAATGTGGTGTTTCATCAGCOvergo seq rv:
Tm:60.0Tm:
IM62 lengthBAC contig(s):
    
MgSTS307Mimulus unigene:MgU386Phytome id:
 Arabidopsis homolog:At4g38670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGCATCATAGTTTTGTTGACCOvergo seq fw:
Reverse primer:TGCCCTCTGCCTTACACCOvergo seq rv:
Tm:59.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS308Mimulus unigene:MgU389Phytome id:
 Arabidopsis homolog:At5g01320
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 100.90cM
M. guttatus Irn Mtn Combined(2009)10 104.36cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 125.81cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATTTCAGCCAGGAGCTACGOvergo seq fw:TATTGTCGGAGGTCCGAATTCGAA
Reverse primer:CGCTGTATCTATCAATTCATGTGCOvergo seq rv: GTTCGTACCGTAGTCGTTCGAATT
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC33, MlFPC152
    
MgSTS309Mimulus unigene:MgU393Phytome id:
 Arabidopsis homolog:At5g57660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTCGTTCTTACAGGCCAAGGOvergo seq fw:
Reverse primer:TCACCTCCCAATCAATCAGCOvergo seq rv:
Tm:60.2Tm:
IM62 lengthBAC contig(s):
    
MgSTS310Mimulus unigene:MgU1196Phytome id:mgut564
 Arabidopsis homolog:At5g54110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 3.30cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 96.91cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TAACAAGACCTTCCCCAACGOvergo seq fw:CTGCCTCAACCTGTTGCCGAGCAA
Reverse primer:GATCCCGAGCGTTCTACTCCOvergo seq rv: AGAAGGGAGAAATATCTTGCTCGG
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC539, MlFPC410, MlFPC626
    
MgSTS311Mimulus unigene:MgU1198Phytome id:
 Arabidopsis homolog:At3g29090
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCGGGAGCTGAATTTTCGOvergo seq fw:TTCTTCGTCTATCAATTCTCTCGC
Reverse primer:GCTCACGTGGAACAACACCOvergo seq rv: GAAGCGTGTGACGTGGGCGAGAGA
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS312Mimulus unigene:MgU1199Phytome id:mgut565
 Arabidopsis homolog:At4g24190
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)3 32.75cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 43.95cM

Set:B
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCCTATTATCAAGGAGCTTCGOvergo seq fw:CCGAGGCACCCTATTATCAAGGAG
Reverse primer:GGGTCCGTCAGTACAAATCCOvergo seq rv: ATACTCTCTCACGAAGCTCCTTGA
Tm:58.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC232, MlFPC1042, MlFPC109, MlFPC129, MlFPC134, MlFPC1645, MlFPC1908
    
MgSTS313Mimulus unigene:MgU1327Phytome id:
 Arabidopsis homolog:At3g22960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTCAAACGTCTACGAACAGAGGOvergo seq fw:
Reverse primer:GAAACGACATGAGGCTACGGOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS314Mimulus unigene:MgU1330Phytome id:
 Arabidopsis homolog:At3g10840
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 52.80cM
M. guttatus Irn Mtn Combined(2009)6 37.47cM
M. guttatus IM62_x_DUN RILs(2009)6 42.30cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCGGTTTTGATTCAGATGCOvergo seq fw:AGTTTTTCGGCGTTCCAAGACGGT
Reverse primer:TGTCCGATCATGTTTTACAAGGOvergo seq rv: ACACCGATCGTCTTGTACCGTCTT
Tm:59.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC30, MgFPC942, MlFPC852, MlFPC905
    
MgSTS315Mimulus unigene:MgU1207Phytome id:
 Arabidopsis homolog:At3g52120
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 75.76cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTAACGACAAAGCCTTCTGCOvergo seq fw:GAGCACCAGATGCTGGATTAAGAG
Reverse primer:ATTTTTGTGGCCAAGAATGGOvergo seq rv: CAAAGTGGCACTACGACTCTTAAT
Tm:58.2Tm:65.40
IM62 lengthBAC contig(s):MlFPC542, MlFPC838
    
MgSTS316Mimulus unigene:MgU1216Phytome id:
 Arabidopsis homolog:At4g35220
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 33.70cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 8.63cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCCGGTGGGTATTTCTAACGOvergo seq fw:GGTACTCACGTGGATGCGCCCGGA
Reverse primer:TTGGAACATCAACAAGTAATGCOvergo seq rv: AGTTTTCATACATATGTCCGGGCG
Tm:61.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS317Mimulus unigene:MgU1233Phytome id:mgut581
 Arabidopsis homolog:At4g10760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 77.10cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TTGCTCTTAGCCCTTCATCCOvergo seq fw:
Reverse primer:ATGCTGGAAAGGGTGAGTCCOvergo seq rv:
Tm:59.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS318Mimulus unigene:MgU1239Phytome id:mgut584
 Arabidopsis homolog:At5g13420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 60.52cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:TGGTACACCAGAAGCACTCGOvergo seq fw:GAGAAGATTGGTACACCAGAAGCA
Reverse primer:GCTCCTTTCTTCACCAGAGCOvergo seq rv: TTCCTCGGAGATCGAGTGCTTCTG
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS319Mimulus unigene:MgU1250Phytome id:
 Arabidopsis homolog:At5g03630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TATGCTGTCGGTGATGTTGCOvergo seq fw:
Reverse primer:TTTTTCACTGGCGAAAATCGOvergo seq rv:
Tm:60.7Tm:
IM62 lengthBAC contig(s):
    
MgSTS320Mimulus unigene:MgU1252Phytome id:
 Arabidopsis homolog:At3g11130
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 57.70cM
M. guttatus Irn Mtn Combined(2009)6 31.23cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAATGCAATTGACTGCTTCCOvergo seq fw:GTCCTTGATTAGTTCATCAACCTT
Reverse primer:AACTTTGATCAGATTGGTCTTGCOvergo seq rv: CCGGGAATACAGCGGTAAGGTTGA
Tm:59.3Tm:64.38
IM62 lengthBAC contig(s):
    
MgSTS321Mimulus unigene:MgU1259Phytome id:
 Arabidopsis homolog:At2g26690
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 41.68cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:ACAAACTGCGGAACCAACCOvergo seq fw:
Reverse primer:GCATTCATGACCGTCTAATCGOvergo seq rv:
Tm:61.0Tm:
IM62 lengthBAC contig(s):