Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1900 - 1979) out of 1979 markers

MlSTS6116Mimulus unigene:MlU5575Phytome id:
 Oryza sativa homolog:Os01g24060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGAATCCACCCATTGATGCOvergo seq fw:
Reverse primer:CACCAGCAATGTTACCAAGGOvergo seq rv:
Tm:62.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6117Mimulus unigene:MlU5636Phytome id:
 Oryza sativa homolog:Os12g33100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTTGATGTCTGCTGTTCGOvergo seq fw:
Reverse primer:GTAGGTCCTCATGGCGTTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6118Mimulus unigene:MlU5772Phytome id:
 Oryza sativa homolog:Os01g08200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTGAAGGAGGTTTTGATGCOvergo seq fw:
Reverse primer:GCCTCTTCCATCTTCAGAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6119Mimulus unigene:MlU5777Phytome id:
 Oryza sativa homolog:Os03g52340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGCTATAGACAAATGTAAAATGGOvergo seq fw:
Reverse primer:CAGATACGATGAGGTGAATGTCCOvergo seq rv:
Tm:57.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6120Mimulus unigene:MlU5951Phytome id:
 Oryza sativa homolog:Os03g18590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACGACCATTCTGTTGTTTCCOvergo seq fw:
Reverse primer:CATGCCTACAAACTGGCTACCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6121Mimulus unigene:MlU6032Phytome id:
 Oryza sativa homolog:Os12g30030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGTGAAAATCTTCATGGACACCOvergo seq fw:
Reverse primer:TCTCCACAACCACATGTTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6122Mimulus unigene:MlU6060Phytome id:
 Oryza sativa homolog:Os02g47970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATCTGTTCCCAACAAAAGCOvergo seq fw:
Reverse primer:AGGGCACTTTGGATCTTTCCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6123Mimulus unigene:MlU6157Phytome id:
 Oryza sativa homolog:Os01g23590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGACTGATGGTTCATTACTGCOvergo seq fw:
Reverse primer:ATCACAACCAGCCCTTTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6124Mimulus unigene:MlU6308Phytome id:
 Oryza sativa homolog:Os03g19280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATAAACGAATGTGGGAAGAGGOvergo seq fw:
Reverse primer:AGTAACCACTGGCTCCATCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6125Mimulus unigene:MlU6309Phytome id:
 Oryza sativa homolog:Os03g19280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAACATGTCTGGACTCAGAGCOvergo seq fw:
Reverse primer:CCATGAGTGGGTTACTTCAGGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6126Mimulus unigene:MlU6330Phytome id:
 Oryza sativa homolog:Os02g26700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCTCAGGATTATCACTTTGTACCOvergo seq fw:
Reverse primer:GGATACGGTTCCTTGATCTGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6127Mimulus unigene:MlU6480Phytome id:
 Oryza sativa homolog:Os03g57280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATGTTCTTTTACCCATTCTCGOvergo seq fw:
Reverse primer:AAAAACTCCCATAAAACAAATGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6128Mimulus unigene:MlU6528Phytome id:
 Oryza sativa homolog:Os02g48000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAACATGTCGGGGAAAGAGCOvergo seq fw:
Reverse primer:GAAATGATGTTCTTGATTTCATCGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6129Mimulus unigene:MlU6534Phytome id:
 Oryza sativa homolog:Os04g32690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGAATTAAGTGAAGTATTTTCAGGOvergo seq fw:
Reverse primer:TCATTTTTCTCAATTCTTGTTAAAGGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6130Mimulus unigene:MlU6698Phytome id:
 Oryza sativa homolog:Os05g14590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGAACAATCTGTGGTTCGOvergo seq fw:
Reverse primer:TAGCTTCATCCCCTTCTTCCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6131Mimulus unigene:MlU6819Phytome id:
 Oryza sativa homolog:Os04g30730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGCTGAAGGATCTGAAGGOvergo seq fw:
Reverse primer:ATGGCGCGAGTCTTCTTAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6132Mimulus unigene:MlU6903Phytome id:
 Oryza sativa homolog:Os03g58400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTTTCCCATTGGTTCAGGOvergo seq fw:
Reverse primer:CCATTTCCAGAGATTGATTCGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6133Mimulus unigene:MlU6974Phytome id:
 Oryza sativa homolog:Os05g06760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGAAATGACCAGAGATTGGOvergo seq fw:
Reverse primer:CCTCGGGCTTATAACATAGTGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6134Mimulus unigene:MlU7037Phytome id:
 Oryza sativa homolog:Os06g45670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACACAAGGCGACAGTTTTGGOvergo seq fw:
Reverse primer:CAAAACTTGGAGTACTGGTCAGGOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6135Mimulus unigene:MlU7057Phytome id:
 Oryza sativa homolog:Os04g58060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAATCCTAAGCATGTTTGCOvergo seq fw:
Reverse primer:ACTCCTTCAATGCCATCAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6136Mimulus unigene:MlU7131Phytome id:
 Oryza sativa homolog:Os01g24060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAATTGATGAAGTTATTTTAACTGGOvergo seq fw:
Reverse primer:TTTCCTAAAGCCCACACAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6137Mimulus unigene:MlU7293Phytome id:
 Oryza sativa homolog:Os11g39130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTCGGACAAAGGATTTGGOvergo seq fw:
Reverse primer:CACCTCCAGTCATCTCATCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6138Mimulus unigene:MlU7435Phytome id:
 Oryza sativa homolog:Os09g07300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGGTACCGAATCAGAAACGOvergo seq fw:
Reverse primer:TCTTCTTGTAAACTTCTTTCACTGGOvergo seq rv:
Tm:62.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6139Mimulus unigene:MlU7589Phytome id:
 Oryza sativa homolog:Os05g03020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCCGGAATGACAACTTAGCOvergo seq fw:
Reverse primer:TGGAAACGTTTGTGAGAAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6140Mimulus unigene:MlU7606Phytome id:
 Oryza sativa homolog:Os01g19480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCGCAATGATAAAGATGGOvergo seq fw:
Reverse primer:GTCCAATTGGGGCTACTCCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6141Mimulus unigene:MlU7691Phytome id:
 Oryza sativa homolog:Os02g04040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGTGTATGGGGAAAATCCOvergo seq fw:
Reverse primer:CCTCATACTTGCGGTGATCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6142Mimulus unigene:MlU7798Phytome id:
 Oryza sativa homolog:Os06g21560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACGAGGTGAAGTTAAAAGAAGGOvergo seq fw:
Reverse primer:ACTACTCAGCAATGAGTTAATCTCTCCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6143Mimulus unigene:MlU7979Phytome id:
 Oryza sativa homolog:Os02g56840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCAAATCAAGAACCTACGGOvergo seq fw:
Reverse primer:CCCTCTTTGGGTCTAATCTCGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6144Mimulus unigene:MlU8026Phytome id:
 Oryza sativa homolog:Os11g07910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAATGGGAGGTGACAACTGGOvergo seq fw:
Reverse primer:GGAGCAGAGGGAATTTCACGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6145Mimulus unigene:MlU8110Phytome id:
 Oryza sativa homolog:Os03g52980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCATATCGGCCTTTACGGOvergo seq fw:
Reverse primer:TGAAGATGTCTGGGATGAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6146Mimulus unigene:MlU8127Phytome id:
 Oryza sativa homolog:Os01g59500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGAGCTGGAGACTAGAAAAGGOvergo seq fw:
Reverse primer:TTCATCTTCACGGAGTTTGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6147Mimulus unigene:MlU8188Phytome id:
 Oryza sativa homolog:Os03g42220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCTGATTGGAGCAGAAGCOvergo seq fw:
Reverse primer:GGGCATTGGTAATACTTTTTGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6148Mimulus unigene:MlU8259Phytome id:
 Oryza sativa homolog:Os06g03770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAAGACAGGTGAAGTCCTACGOvergo seq fw:
Reverse primer:TCCACTGCTTTGGTGTTAGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6149Mimulus unigene:MlU8279Phytome id:
 Oryza sativa homolog:Os01g09000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGAGAGCAGATGGAGAGGOvergo seq fw:
Reverse primer:TTAGGTTCTGGAGGGAATCGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6150Mimulus unigene:MlU8318Phytome id:
 Oryza sativa homolog:Os12g42260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGTGATGACCACTGTGACCOvergo seq fw:
Reverse primer:GTTGTGTATGATGGCGAAGGOvergo seq rv:
Tm:62.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6151Mimulus unigene:MlU8371Phytome id:
 Oryza sativa homolog:Os10g08930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAAGGGTCCAGTTAGAATGCOvergo seq fw:
Reverse primer:TCGACACCAGGTTCAATGGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6152Mimulus unigene:MlU8375Phytome id:
 Oryza sativa homolog:Os03g19960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAACAACGTCAGAGTTTGCOvergo seq fw:
Reverse primer:CCTCATCCAACATGATTACAGCOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6153Mimulus unigene:MlU8461Phytome id:
 Oryza sativa homolog:Os03g27250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGACAGCAGTTTTGGTGAGCOvergo seq fw:
Reverse primer:CGAGGTTGATGACAACATGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6154Mimulus unigene:MlU8476Phytome id:
 Oryza sativa homolog:Os01g59530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAACTTACAGAAGAACAGATTGCOvergo seq fw:
Reverse primer:CTTGGAAGTCATCATTGTAACGOvergo seq rv:
Tm:57.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6155Mimulus unigene:MlU8689Phytome id:
 Oryza sativa homolog:Os05g07030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGTGAAGGTTAATCCAAGGOvergo seq fw:
Reverse primer:ATCGTGACCAACCCATTCCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6156Mimulus unigene:MlU8760Phytome id:
 Oryza sativa homolog:Os02g47970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCAGCCGATAACACTTCCOvergo seq fw:
Reverse primer:TTTAAGGGCTTCATAGCATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6157Mimulus unigene:MlU8767Phytome id:
 Oryza sativa homolog:Os03g17780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCCAACACATTAATCACACCOvergo seq fw:
Reverse primer:GAATCTGTTGTTCAATTTATGAAAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6158Mimulus unigene:MlU8867Phytome id:
 Oryza sativa homolog:Os03g46490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATGAGGGTCAAAACATGGOvergo seq fw:
Reverse primer:TCTCATCCAAATGGCCTACGOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6159Mimulus unigene:MlU8915Phytome id:
 Oryza sativa homolog:Os03g55784
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCCAAGTTTGCCTTTTGCOvergo seq fw:
Reverse primer:AAATTTGCTAGTTGCCTCAGCOvergo seq rv:
Tm:57.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6160Mimulus unigene:MlU8923Phytome id:
 Oryza sativa homolog:Os02g29464
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGCTTTTGTCCATGATCCOvergo seq fw:
Reverse primer:CCTTTTGTGTTCCTATCATTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6161Mimulus unigene:MlU9056Phytome id:
 Oryza sativa homolog:Os02g10020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACATGGATGGAAGAAACCOvergo seq fw:
Reverse primer:CCTAGGAGTTCATACGCACTGGOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6162Mimulus unigene:MlU9082Phytome id:
 Oryza sativa homolog:Os03g25620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTCGAACACAATCAGAACGOvergo seq fw:
Reverse primer:CCTCTTCTGGGTCATCTTCCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6163Mimulus unigene:MlU9125Phytome id:
 Oryza sativa homolog:Os02g56740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCTACGAGATGCAGGTTGGOvergo seq fw:
Reverse primer:CATCCCCAAGAGAGTAACATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6164Mimulus unigene:MlU9155Phytome id:
 Oryza sativa homolog:Os03g52010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGAAAAACATTTGACTCACCOvergo seq fw:
Reverse primer:GAAATCATGAGCCGAAGAGGOvergo seq rv:
Tm:57.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6165Mimulus unigene:MlU9236Phytome id:
 Oryza sativa homolog:Os02g52900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAATCGGCATTCTTCGOvergo seq fw:
Reverse primer:TTTGCACAAGCTCGACTCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6166Mimulus unigene:MlU9264Phytome id:
 Oryza sativa homolog:Os02g08360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGAAGGAAAGCAAAAGTCAGCOvergo seq fw:
Reverse primer:CGTTCTTCATCTGTCCTTGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6167Mimulus unigene:MlU9362Phytome id:
 Oryza sativa homolog:Os11g38170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCAGTCAAGGGCATAAACCOvergo seq fw:
Reverse primer:TACCAAATTGCCTGGTCAGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6168Mimulus unigene:MlU9374Phytome id:
 Oryza sativa homolog:Os12g29660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGCATGTGCTGTTACTGGOvergo seq fw:
Reverse primer:AACAGCAAGTTCTCTGGTTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6169Mimulus unigene:MlU9395Phytome id:
 Oryza sativa homolog:Os05g05260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTGAATCCACAGAGGAAGCOvergo seq fw:
Reverse primer:TGTGTTGGGAGAGTTCTTCGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6170Mimulus unigene:MlU9420Phytome id:
 Oryza sativa homolog:Os06g01650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGTTTGCAACCAATGAAGCOvergo seq fw:
Reverse primer:AGGGTTCCCCAAAGACTGGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6171Mimulus unigene:MlU9450Phytome id:
 Oryza sativa homolog:Os02g14929
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCTACTAGCACCACCTTCGOvergo seq fw:
Reverse primer:GCTTTGGAGATTATCCCTTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6172Mimulus unigene:MlU9484Phytome id:
 Oryza sativa homolog:Os02g07120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTATTTGTCGGCCAATCTCCOvergo seq fw:
Reverse primer:GCAGATATTAGGCATGCAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6173Mimulus unigene:MlU9548Phytome id:
 Oryza sativa homolog:Os05g48060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTTACCAGCCTCACACGOvergo seq fw:
Reverse primer:TGACATCATTTCTCATGAAAGCOvergo seq rv:
Tm:57.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6174Mimulus unigene:MlU9628Phytome id:
 Oryza sativa homolog:Os03g07430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTATGCTGCTCCTGAATACGOvergo seq fw:
Reverse primer:CAAAGCTGTATACGTCACTTTTCGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6175Mimulus unigene:MlU9646Phytome id:
 Oryza sativa homolog:Os07g12650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGAAGTCGTTGGCTCATGGOvergo seq fw:
Reverse primer:ACAACCTTCCTTGCCTTTCCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6176Mimulus unigene:MlU9647Phytome id:
 Oryza sativa homolog:Os07g12650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACTTTCCTCGCCATAATCCOvergo seq fw:
Reverse primer:CGCTGAACACAATGTGAACCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6177Mimulus unigene:MlU9651Phytome id:
 Oryza sativa homolog:Os09g07900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCTTGGCTTGAGTACATCGOvergo seq fw:
Reverse primer:CCAGATTATGAACTCGGACAGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6178Mimulus unigene:MlU9675Phytome id:
 Oryza sativa homolog:Os01g66360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGTTAGACAAAGTCCATGTAGCOvergo seq fw:
Reverse primer:GATAGACCGATGCCTTGTAGCOvergo seq rv:
Tm:57.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6179Mimulus unigene:MlU9748Phytome id:
 Oryza sativa homolog:Os09g06970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCGTTAGGATTCCGTGTCGOvergo seq fw:
Reverse primer:ACTCCCATGTGATTGGTACGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6180Mimulus unigene:MlU9761Phytome id:
 Oryza sativa homolog:Os01g34614
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCAAGAAAACACACTGAAGCOvergo seq fw:
Reverse primer:AACAATTCGGCGGGTACGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6181Mimulus unigene:MlU9785Phytome id:
 Oryza sativa homolog:Os05g28280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTCACCGTGTTGCTAATGCOvergo seq fw:
Reverse primer:CTTTGTGCCCAATGCTAACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6182Mimulus unigene:MlU9821Phytome id:
 Oryza sativa homolog:Os05g08970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGTCTGTTGGCTGAAACGOvergo seq fw:
Reverse primer:TGTTGCATGTGAGACATTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6183Mimulus unigene:MlU9873Phytome id:
 Oryza sativa homolog:Os09g15340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGACACTGATGAATATTGAAAGAGCOvergo seq fw:
Reverse primer:CCATTCAGGTGAGTTCCATAGGOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6184Mimulus unigene:MlU9900Phytome id:
 Oryza sativa homolog:Os10g32880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTACTCTCAAACCCCAAGCOvergo seq fw:
Reverse primer:TTCTGAGCTCGCCAAACCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6185Mimulus unigene:MlU9958Phytome id:
 Oryza sativa homolog:Os06g36160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATTTTCTGCTTTGGTTTCCOvergo seq fw:
Reverse primer:GCACCAATTTTGGTTTTAGCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6186Mimulus unigene:MlU9959Phytome id:
 Oryza sativa homolog:Os06g36160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCTTTCTTTTCCCTGTTTGCOvergo seq fw:
Reverse primer:CAGAGATCCGTGAAAAATTAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6187Mimulus unigene:MlU9972Phytome id:
 Oryza sativa homolog:Os02g22130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAAGGGTTCGAAGGTCTCCOvergo seq fw:
Reverse primer:TCTGCTACCTGGAAAATTAAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6188Mimulus unigene:MlU9983Phytome id:
 Oryza sativa homolog:Os12g19370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCTTTTGGTCTTGCTTACCOvergo seq fw:
Reverse primer:AACCTTTTCTTTGTCCTTTGGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6189Mimulus unigene:MlU9993Phytome id:
 Oryza sativa homolog:Os08g08200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAAGAAAGGTCGAATCAGCOvergo seq fw:
Reverse primer:TCTCTTCTTTTACTGTTCTGGTTCCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6190Mimulus unigene:MlU10035Phytome id:
 Oryza sativa homolog:Os03g51230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAATTTAACTGGCGCTATCTCGOvergo seq fw:
Reverse primer:TCGCTGCATTTTACTGAGACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6191Mimulus unigene:MlU10036Phytome id:
 Oryza sativa homolog:Os01g27040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTTTTCTTTCTCTTCCAACTCCOvergo seq fw:
Reverse primer:TGAAGCTAAGATCCAAAGAAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6192Mimulus unigene:MlU10072Phytome id:
 Oryza sativa homolog:Os04g36620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTATGCCGGACAAGAAAGGOvergo seq fw:
Reverse primer:ATTATTACTTGCTGGTGTTGACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6193Mimulus unigene:MlU10175Phytome id:
 Oryza sativa homolog:Os02g47970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGATCTCAATGCACTAACTGGOvergo seq fw:
Reverse primer:TGCTCAGAAAATCTTCCTTTCCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6194Mimulus unigene:MlU10229Phytome id:
 Oryza sativa homolog:Os02g07760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTTGAAGGTGGGTGATGGOvergo seq fw:
Reverse primer:CATCTTTGACAAGAGAGTCAACCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):