Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1800 - 1899) out of 1979 markers

MlSTS6014Mimulus unigene:MlU3580Phytome id:
 Oryza sativa homolog:Os02g42820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGAGAAATCGACGAGAACCOvergo seq fw:
Reverse primer:CACCAAGCAAGCTCTCAGCOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6015Mimulus unigene:MlU3594Phytome id:
 Oryza sativa homolog:Os09g24910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACATGTGGAGGCCTTTGTCCOvergo seq fw:
Reverse primer:TCCCACAATCTTTTTCACACCOvergo seq rv:
Tm:62.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6016Mimulus unigene:MlU3607Phytome id:
 Oryza sativa homolog:Os09g09470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAGCGTAAACGAATTTCCOvergo seq fw:
Reverse primer:GGGATGCGTCATCTTTTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6017Mimulus unigene:MlU3612Phytome id:
 Oryza sativa homolog:Os05g45050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGTGCACAAGGTTCTAGGCOvergo seq fw:
Reverse primer:GCAACACCAAGCACACTACCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6018Mimulus unigene:MlU3629Phytome id:
 Oryza sativa homolog:Os02g57180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAATTTTCTCACTAACTGTTGAACCOvergo seq fw:
Reverse primer:TCCATTGCCTGTCCCTAGCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6019Mimulus unigene:MlU3640Phytome id:
 Oryza sativa homolog:Os07g07950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCGTAATTGTCTGAATTGGOvergo seq fw:
Reverse primer:CCGTCACTCGTGTACTCAACCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6020Mimulus unigene:MlU3644Phytome id:
 Oryza sativa homolog:Os02g01010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGCTGAGAGTGAAGAGTTGGOvergo seq fw:
Reverse primer:TCTTGCGAGTCATTTGATGCOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6021Mimulus unigene:MlU3656Phytome id:
 Oryza sativa homolog:Os12g02380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAGTTCCTCCATGTGAAACCOvergo seq fw:
Reverse primer:CAGCCTCTTCCAACTTACTTCCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6022Mimulus unigene:MlU3657Phytome id:
 Oryza sativa homolog:Os12g02380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACCGGTATCAAAAATTGCOvergo seq fw:
Reverse primer:AAGGTCATCGATTTTGAACTCCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6023Mimulus unigene:MlU3681Phytome id:
 Oryza sativa homolog:Os11g09280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCCATCGTACTGGCAAAGGOvergo seq fw:
Reverse primer:TCAGCAAGCGAAGAGTTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6024Mimulus unigene:MlU3689Phytome id:
 Oryza sativa homolog:Os11g07910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCAGGGTATACTGCATCCOvergo seq fw:
Reverse primer:AGCTTGAAACTCTGCCTTGCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6025Mimulus unigene:MlU3702Phytome id:
 Oryza sativa homolog:Os12g31490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGGGTCCCCCTAAATCGOvergo seq fw:
Reverse primer:GCTGCGTTAGCAAAACAACCOvergo seq rv:
Tm:62.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6026Mimulus unigene:MlU3703Phytome id:
 Oryza sativa homolog:Os05g48510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGCAAGCATCAGTCAGGOvergo seq fw:
Reverse primer:CCTCTTAAAACTGCACAGACGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6027Mimulus unigene:MlU3712Phytome id:
 Oryza sativa homolog:Os08g08050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAAGGAAATCCTGGACAAGCOvergo seq fw:
Reverse primer:GCGAGTGCAAATTTCAAACCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6028Mimulus unigene:MlU3729Phytome id:
 Oryza sativa homolog:Os08g29170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAAAGGGCTGGTTTTTCCOvergo seq fw:
Reverse primer:ATCCTCGAAGTTGTCCTTGGOvergo seq rv:
Tm:61.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6029Mimulus unigene:MlU3750Phytome id:
 Oryza sativa homolog:Os10g31950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGAAGGCATTGATTGATCGOvergo seq fw:
Reverse primer:TATGAAGGCAGCCACATCGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6030Mimulus unigene:MlU3761Phytome id:
 Oryza sativa homolog:Os06g07600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACTCCAACGTCACCAATCCOvergo seq fw:
Reverse primer:GATGCCTGTTTCACTCAAGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6031Mimulus unigene:MlU3803Phytome id:
 Oryza sativa homolog:Os04g32330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGGCGATACTGTTGAAGCOvergo seq fw:
Reverse primer:TCTTCAGCAGGAGGAGATGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6032Mimulus unigene:MlU3804Phytome id:
 Oryza sativa homolog:Os04g32330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACACCACCGTTGGATATGGOvergo seq fw:
Reverse primer:CAATAGTGAATGCTGTTATTGATGGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6033Mimulus unigene:MlU3815Phytome id:
 Oryza sativa homolog:Os05g32850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGTGGTGGTTTGTGTACGOvergo seq fw:
Reverse primer:TTGCACAGTAACAGAGTCACGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6035Mimulus unigene:MlU3823Phytome id:
 Oryza sativa homolog:Os01g05430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGTGATGTGCTGTTGTTGCOvergo seq fw:
Reverse primer:TTGATCCGACCTCAATTTGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6036Mimulus unigene:MlU3824Phytome id:
 Oryza sativa homolog:Os05g49200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCCAATCTGTGGGTTCCOvergo seq fw:
Reverse primer:GCAACCAAAAATGTGACACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6037Mimulus unigene:MlU3830Phytome id:
 Oryza sativa homolog:Os10g42250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTCGATTGCTTCGATCTGCOvergo seq fw:
Reverse primer:TTTGTCGCACTTGTTTTATGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6038Mimulus unigene:MlU3849Phytome id:
 Oryza sativa homolog:Os01g43700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTCTGTGCCTTTGACACCOvergo seq fw:
Reverse primer:GACGAAAGCTCGTGAAGAGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6039Mimulus unigene:MlU3857Phytome id:
 Oryza sativa homolog:Os11g29370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTGATTCTCCGGAAGAGGOvergo seq fw:
Reverse primer:GGCAATACAAGTTTTGGAGACCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6040Mimulus unigene:MlU3867Phytome id:
 Oryza sativa homolog:Os11g18880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACTCAAAACTGTTAGAAACATCCOvergo seq fw:
Reverse primer:CTGAAAAATTTGACGCTTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6041Mimulus unigene:MlU3868Phytome id:
 Oryza sativa homolog:Os11g18880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCGTGGTTTAAGGTGTGGOvergo seq fw:
Reverse primer:TCTTTAATAGGCAGGCACTGGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6042Mimulus unigene:MlU3870Phytome id:
 Oryza sativa homolog:Os04g31000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCTCTCTGACAAACTTAGTTGCOvergo seq fw:
Reverse primer:TTGAGGTCGTTGAGTTAGATCCOvergo seq rv:
Tm:57.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6043Mimulus unigene:MlU3890Phytome id:
 Oryza sativa homolog:Os06g39600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCTGCAACTCCTTCAACCOvergo seq fw:
Reverse primer:GGACTGAAAGGCCAAAACGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6044Mimulus unigene:MlU3899Phytome id:
 Oryza sativa homolog:Os05g24020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTGGGATTTCTCACTGGOvergo seq fw:
Reverse primer:GTGCACTCTACGCTGAATCCOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6045Mimulus unigene:MlU3906Phytome id:
 Oryza sativa homolog:Os03g43930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTGCTGTTGTTGCTGACCOvergo seq fw:
Reverse primer:GAAGAGAATGACCGCCTTCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6046Mimulus unigene:MlU3947Phytome id:
 Oryza sativa homolog:Os04g47040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAGCTTGCCTGATCACACCOvergo seq fw:
Reverse primer:GAATCCAACAAAGAAGCAACGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6047Mimulus unigene:MlU4023Phytome id:
 Oryza sativa homolog:Os01g03950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCTTCTCGACGATCAAACCOvergo seq fw:
Reverse primer:AGAGAGCAAGTTTGCGTTGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6048Mimulus unigene:MlU4083Phytome id:
 Oryza sativa homolog:Os01g26160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAGGAAAAGCTTCTTAGGGOvergo seq fw:
Reverse primer:ATTCACCATCGGTCCAACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6049Mimulus unigene:MlU4096Phytome id:
 Oryza sativa homolog:Os01g65100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGAAAACATCAGCAACACCOvergo seq fw:
Reverse primer:GTGCCGATGAGTGTGTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6050Mimulus unigene:MlU4117Phytome id:
 Oryza sativa homolog:Os06g05180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCAATTGGGGGAGTTAGCOvergo seq fw:
Reverse primer:GCAAGAGATGCAAGTTCAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6051Mimulus unigene:MlU4155Phytome id:
 Oryza sativa homolog:Os01g12730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTTTTCCAGCCAGTACAAGGOvergo seq fw:
Reverse primer:CACGGTAGAATGCCACACCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6052Mimulus unigene:MlU4185Phytome id:
 Oryza sativa homolog:Os04g01290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTATTGGAGAACCCATACAGCOvergo seq fw:
Reverse primer:AAATTCAATAACAGTGTGAACAGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6053Mimulus unigene:MlU4186Phytome id:
 Oryza sativa homolog:Os04g01290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATTTTGTTCGCTTGAATGGOvergo seq fw:
Reverse primer:GAGCCATGGATTGTCAAGGOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6054Mimulus unigene:MlU4217Phytome id:
 Oryza sativa homolog:Os01g46720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACAACAAGGCAGAACCATCCOvergo seq fw:
Reverse primer:AAATTGAGAGCTGGGAGACGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6055Mimulus unigene:MlU4249Phytome id:
 Oryza sativa homolog:Os11g34130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAATGTCTGAACTTGTGTTCCOvergo seq fw:
Reverse primer:GAGGGCTCGACCTGATGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6056Mimulus unigene:MlU4261Phytome id:
 Oryza sativa homolog:Os02g49320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGTCTGATAGAGTCAGAAGTGGOvergo seq fw:
Reverse primer:ATCCGCTCAATGACTTCTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6057Mimulus unigene:MlU4262Phytome id:
 Oryza sativa homolog:Os02g49320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCCGCTCAATGACTTCTCCOvergo seq fw:
Reverse primer:GATGCTGATGGAAAGATTGCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6058Mimulus unigene:MlU4303Phytome id:
 Oryza sativa homolog:Os07g04180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTATCGGAATCGGTCTCGOvergo seq fw:
Reverse primer:CGATCGGTATTCCTGTGAGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6059Mimulus unigene:MlU4341Phytome id:
 Oryza sativa homolog:Os09g39570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTGGCAAGTTCTGAATGCOvergo seq fw:
Reverse primer:CGTGCATTCTCTTGACAAACCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6060Mimulus unigene:MlU4347Phytome id:
 Oryza sativa homolog:Os06g49080
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCCGAGAAGCAGCAACCOvergo seq fw:
Reverse primer:AGCTGATGTCACCAACAACGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6061Mimulus unigene:MlU4352Phytome id:
 Oryza sativa homolog:Os01g47450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATTCAGTCAAGATCAAGAGCOvergo seq fw:
Reverse primer:ATCGTACCTTGCCATCTTGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6062Mimulus unigene:MlU4357Phytome id:
 Oryza sativa homolog:Os03g06620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACAGGGAGGAAGTTATTCAGGOvergo seq fw:
Reverse primer:CGGATTTTCTTCAACTCAGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6063Mimulus unigene:MlU4366Phytome id:
 Oryza sativa homolog:Os06g05980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAACACCTGTCTTACTCTTCTGCOvergo seq fw:
Reverse primer:AGTTCACCTGGCTGAAAGCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6064Mimulus unigene:MlU4383Phytome id:
 Oryza sativa homolog:Os07g48430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGTGGTGTCATTCTATTGGOvergo seq fw:
Reverse primer:GTAGCCCCAACTCTGACTGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6065Mimulus unigene:MlU4434Phytome id:
 Oryza sativa homolog:Os02g52410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACAACTCTCATTGTTTGTTCCOvergo seq fw:
Reverse primer:CAAATGACGTGGCAGTTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6066Mimulus unigene:MlU4437Phytome id:
 Oryza sativa homolog:Os10g37740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGACAATAAAACCGATAATCACGOvergo seq fw:
Reverse primer:AACCAGTGCCAACAACACGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6067Mimulus unigene:MlU4490Phytome id:
 Oryza sativa homolog:Os02g46520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTCTGTCGAAGCTGATCGOvergo seq fw:
Reverse primer:TCCTCTATTGGGCTTGAACGOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6068Mimulus unigene:MlU4494Phytome id:
 Oryza sativa homolog:Os02g29480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTGGATGCACAGGACTCGOvergo seq fw:
Reverse primer:TTCCTCAATTTTGGCACTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6069Mimulus unigene:MlU4497Phytome id:
 Oryza sativa homolog:Os03g04500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTATACGAGCTTGTCTCAGTGGOvergo seq fw:
Reverse primer:CACCAAACCGAGATTGTACCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6070Mimulus unigene:MlU4504Phytome id:
 Oryza sativa homolog:Os05g32110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGAGTTGGACAGCTGATGGOvergo seq fw:
Reverse primer:AGTTCCGGGCAATAGATCGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6071Mimulus unigene:MlU4526Phytome id:
 Oryza sativa homolog:Os03g02756
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCTCTTGCCTCTCAGTCCOvergo seq fw:
Reverse primer:CCCCTTAACAAAGTGGCTACGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6072Mimulus unigene:MlU4534Phytome id:
 Oryza sativa homolog:Os07g10720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTCAGTGTGTTGAACGATGCOvergo seq fw:
Reverse primer:TTTAGTTCAACCACGATTTTTCCOvergo seq rv:
Tm:57.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6073Mimulus unigene:MlU4582Phytome id:
 Oryza sativa homolog:Os10g33800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTGTTGAAGCTTGCACTGGOvergo seq fw:
Reverse primer:TTGGTGTTGGCAGGATTAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6074Mimulus unigene:MlU4602Phytome id:
 Oryza sativa homolog:Os06g06030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCACCCGATAGCTTTGTCCOvergo seq fw:
Reverse primer:CAGCGGTAATGCTCTTCTCCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6075Mimulus unigene:MlU4603Phytome id:
 Oryza sativa homolog:Os01g51890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTTGGTTCCGAAGACAACCOvergo seq fw:
Reverse primer:TTCATCCTCAAAATCACTGTCGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6076Mimulus unigene:MlU4626Phytome id:
 Oryza sativa homolog:Os12g06890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCTTCCACTGGCTTTGGOvergo seq fw:
Reverse primer:CTAACGGTTGTCCGAATGCOvergo seq rv:
Tm:61.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6077Mimulus unigene:MlU4637Phytome id:
 Oryza sativa homolog:Os11g19130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCTTGAGCTGAGGCAAAGGOvergo seq fw:
Reverse primer:GCAATAACTGGCTGTGAAGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6078Mimulus unigene:MlU4656Phytome id:
 Oryza sativa homolog:Os05g02060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAAGAATGCAATGGTAGGOvergo seq fw:
Reverse primer:TGAGGAACTCAGAAGCAGTAGCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6079Mimulus unigene:MlU4683Phytome id:
 Oryza sativa homolog:Os03g60880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTGTCGAGCGTATTGTCGOvergo seq fw:
Reverse primer:GCAGTTTTTGCTTCGATTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6080Mimulus unigene:MlU4694Phytome id:
 Oryza sativa homolog:Os10g35250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGGTTTGGAAGGTGAGCOvergo seq fw:
Reverse primer:GCATCCAGAGACATGATTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6081Mimulus unigene:MlU4730Phytome id:
 Oryza sativa homolog:Os07g09720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGCATCGGAAGTTTTGTTGGOvergo seq fw:
Reverse primer:TCAACTTTTCCAGCTTTTCTCCOvergo seq rv:
Tm:62.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6082Mimulus unigene:MlU4731Phytome id:
 Oryza sativa homolog:Os07g09720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGCTTCTTGAGTCGATGCOvergo seq fw:
Reverse primer:GAGACGCATTAAGTGGTTTGCOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6083Mimulus unigene:MlU4733Phytome id:
 Oryza sativa homolog:Os02g02930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGAAAGAGAAGAGCTTAGGGOvergo seq fw:
Reverse primer:TTATGGTGGAGGCAAAGTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6084Mimulus unigene:MlU4748Phytome id:
 Oryza sativa homolog:Os02g40784
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTGTTTTCGATTCCACTCCOvergo seq fw:
Reverse primer:GAATCCGGTGTGGTGAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6085Mimulus unigene:MlU4749Phytome id:
 Oryza sativa homolog:Os10g33250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCAAAGCATGCAATATCCOvergo seq fw:
Reverse primer:CGTTTTACGAGAACGAGAAGCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6086Mimulus unigene:MlU4754Phytome id:
 Oryza sativa homolog:Os03g49750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGGTAGTTTAGGTGGAACTGGOvergo seq fw:
Reverse primer:TTTTCGGAATATAAAACTTTCTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6088Mimulus unigene:MlU4763Phytome id:
 Oryza sativa homolog:Os11g06040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCAATTTAAGAAAGAATGTGCOvergo seq fw:
Reverse primer:GTTATCGCACAAGGGATTCGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6089Mimulus unigene:MlU4774Phytome id:
 Oryza sativa homolog:Os01g48720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGATTCTTGCTGGAAATGGOvergo seq fw:
Reverse primer:CCGACTTCAAAGCATCTTGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6090Mimulus unigene:MlU4780Phytome id:
 Oryza sativa homolog:Os01g59130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTGTCGACATGGAACACGOvergo seq fw:
Reverse primer:GGAGCATATACGCACTTATTGGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6091Mimulus unigene:MlU4787Phytome id:
 Oryza sativa homolog:Os05g44360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTTCCGATTCTTTTTGAGCOvergo seq fw:
Reverse primer:GCCAACCATGCTTAACAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6092Mimulus unigene:MlU4808Phytome id:
 Oryza sativa homolog:Os07g49300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGATCTCAAGAGAAAACAGGOvergo seq fw:
Reverse primer:TGACTCTGGAAATGGGTTCCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6093Mimulus unigene:MlU4826Phytome id:
 Oryza sativa homolog:Os05g37434
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATCAAATGCATGTCGTAGGOvergo seq fw:
Reverse primer:GGATGAGATGGCTGAACTCGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6094Mimulus unigene:MlU4835Phytome id:
 Oryza sativa homolog:Os06g11600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAAAATGCCTCTTCCGAACGOvergo seq fw:
Reverse primer:GGCAAGAGCGGTTGAAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6095Mimulus unigene:MlU4844Phytome id:
 Oryza sativa homolog:Os02g11740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCCTCTTGCGATTATGAGGOvergo seq fw:
Reverse primer:TTTAGAGAGATGGCCCAACCOvergo seq rv:
Tm:62.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6096Mimulus unigene:MlU4863Phytome id:
 Oryza sativa homolog:Os03g53720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTATCACGCCGTCAGAATCGOvergo seq fw:
Reverse primer:AAGACGGAGCAAACTATCACCOvergo seq rv:
Tm:61.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6097Mimulus unigene:MlU4867Phytome id:
 Oryza sativa homolog:Os01g13770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTATCGCAATGGAAGTACCGOvergo seq fw:
Reverse primer:TGATGCAATTGCTAAAGTGGOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6098Mimulus unigene:MlU4884Phytome id:
 Oryza sativa homolog:Os12g41140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGGCGAGAGCGTTAAAGGOvergo seq fw:
Reverse primer:TGGTGATGGTATTCGCTACGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6099Mimulus unigene:MlU4896Phytome id:
 Oryza sativa homolog:Os11g26850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGCTTCCCAAGATGAAGAGCOvergo seq fw:
Reverse primer:ATCTTCGTCACCACCACAGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS6100Mimulus unigene:MlU4908Phytome id:
 Oryza sativa homolog:Os03g38930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCCTCTAACATCAAATTCTTCGOvergo seq fw:
Reverse primer:TGCTGTGCATACCACATTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6101Mimulus unigene:MlU4941Phytome id:
 Oryza sativa homolog:Os10g33250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCAGGTGTGTTGTTGTACGOvergo seq fw:
Reverse primer:ATTCCAAAGGGAACAACTCGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6102Mimulus unigene:MlU4991Phytome id:
 Oryza sativa homolog:Os08g09320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACCAGTCTTTGGATCACGOvergo seq fw:
Reverse primer:CCAGAAAAGGCAATGTGTGCOvergo seq rv:
Tm:57.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6103Mimulus unigene:MlU5006Phytome id:
 Oryza sativa homolog:Os06g51500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCAAGAAAACCTTGTCTGCOvergo seq fw:
Reverse primer:GGGTCTTGCACTTTCTTTTCGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6104Mimulus unigene:MlU5021Phytome id:
 Oryza sativa homolog:Os07g48290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCATTTCATTCGAACACGOvergo seq fw:
Reverse primer:CTGGTACACTTTCCCAAACGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6105Mimulus unigene:MlU5042Phytome id:
 Oryza sativa homolog:Os03g59590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCAACCCAACAAAAGTAGCOvergo seq fw:
Reverse primer:TGAAAGAAAGAGATCTCAATGACGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6106Mimulus unigene:MlU5047Phytome id:
 Oryza sativa homolog:Os07g01760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTAAAGGACTGCGTGATGCOvergo seq fw:
Reverse primer:CATTCGATTTAGCCGTTTCCOvergo seq rv:
Tm:57.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6107Mimulus unigene:MlU5082Phytome id:
 Oryza sativa homolog:Os01g54470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACGGAGCAAGAAAAGTAGCCOvergo seq fw:
Reverse primer:CTCCCTCTCACACAATGACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6108Mimulus unigene:MlU5084Phytome id:
 Oryza sativa homolog:Os02g08180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCCTTGGACTCAGTTTTCGOvergo seq fw:
Reverse primer:CGACGATAATGTTGTTGATGGOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6109Mimulus unigene:MlU5189Phytome id:
 Oryza sativa homolog:Os03g08830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCAGCTGACTGCAAGATCCOvergo seq fw:
Reverse primer:CAGAACATAAACGGAACATTCGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6110Mimulus unigene:MlU5265Phytome id:
 Oryza sativa homolog:Os04g51610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGATGGTGTGAATGATGCOvergo seq fw:
Reverse primer:TTACCAAGTTGACCCACAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS6111Mimulus unigene:MlU5280Phytome id:
 Oryza sativa homolog:Os04g53770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACAGGTAGCACTTTGTTATGCOvergo seq fw:
Reverse primer:TGACTGTTTTGGCATCTTTCCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6112Mimulus unigene:MlU5306Phytome id:
 Oryza sativa homolog:Os03g21080
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCCAGAATCATAGAACAAGCOvergo seq fw:
Reverse primer:TCACATTCTCTTTGCCGTAGCOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6113Mimulus unigene:MlU5339Phytome id:
 Oryza sativa homolog:Os08g09200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTCAAGATGCCACCATTCGOvergo seq fw:
Reverse primer:AATCCCTTGGCCTGACTGGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6114Mimulus unigene:MlU5435Phytome id:
 Oryza sativa homolog:Os08g42560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGCAAACCTTCTGCAAGCOvergo seq fw:
Reverse primer:TTTACTCATTCCATCAATCTTTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS6115Mimulus unigene:MlU5542Phytome id:
 Oryza sativa homolog:Os05g46330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCACCTGTTTGACCTGTGCOvergo seq fw:
Reverse primer:TCGGGTATTTACTGCGATCCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):