Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1700 - 1799) out of 1979 markers

MlSTS5910Mimulus unigene:MlU2064Phytome id:
 Oryza sativa homolog:Os04g40310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGAAGAAAGAAGCAAAGCOvergo seq fw:
Reverse primer:GTGACGCCCAATCTTTATGGOvergo seq rv:
Tm:57.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5911Mimulus unigene:MlU2102Phytome id:
 Oryza sativa homolog:Os10g35580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGCCTATGCTCAGTTCATGGOvergo seq fw:
Reverse primer:TGGAATCTTCCTTTCACAAGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5912Mimulus unigene:MlU2104Phytome id:
 Oryza sativa homolog:Os03g16980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTCGCATAAGACCATCAACCOvergo seq fw:
Reverse primer:TTCATAGCGCAAGCAATACGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5913Mimulus unigene:MlU2106Phytome id:
 Oryza sativa homolog:Os03g23950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCTGCCAATACCCAGATGCOvergo seq fw:
Reverse primer:AGGTCCCCTGAACCCTAACCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5915Mimulus unigene:MlU2162Phytome id:
 Oryza sativa homolog:Os08g36220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGAAGTTGCTTGTAGAATGGOvergo seq fw:
Reverse primer:AGAACAGTCCGCTTTTCTCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5916Mimulus unigene:MlU2168Phytome id:
 Oryza sativa homolog:Os05g35740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAAGCCAGAAGGACAAGAGCOvergo seq fw:
Reverse primer:CACCTGGTTGTTTTGAGAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5917Mimulus unigene:MlU2172Phytome id:
 Oryza sativa homolog:Os03g54910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATTGATACACACATCCAGAAGCOvergo seq fw:
Reverse primer:GCTTGTCTTGGCTATGATCGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5918Mimulus unigene:MlU2193Phytome id:
 Oryza sativa homolog:Os08g29170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCCTCGAAGTTGTCCTTGGOvergo seq fw:
Reverse primer:CGAAAGGGCTGGTTTTTCCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5919Mimulus unigene:MlU2209Phytome id:
 Oryza sativa homolog:Os03g06940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGTTTCACGCAGAAAATCGOvergo seq fw:
Reverse primer:ATCGTCTTTGCACATGATCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5920Mimulus unigene:MlU2212Phytome id:
 Oryza sativa homolog:Os02g12850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGAATCCGACCAACAATCGOvergo seq fw:
Reverse primer:AAAGGTGACAAAGCAGAAACGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5921Mimulus unigene:MlU2267Phytome id:
 Oryza sativa homolog:Os05g06260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTGCTTGGATGTTGTATGGOvergo seq fw:
Reverse primer:TTCTAGCATTGGCTTCATGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5922Mimulus unigene:MlU2273Phytome id:
 Oryza sativa homolog:Os03g27310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGATGGTGACACGTTTGGOvergo seq fw:
Reverse primer:CCCTGGTACTGTTGCTCTCCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5923Mimulus unigene:MlU2282Phytome id:
 Oryza sativa homolog:Os03g10110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCCAATGTTCGGAAAACCOvergo seq fw:
Reverse primer:GTGGCAGTGGTCCTACAAGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5924Mimulus unigene:MlU2301Phytome id:
 Oryza sativa homolog:Os12g44000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTCCTCGTTATCCATTCGOvergo seq fw:
Reverse primer:TGTGACCGTTGCTGTAAACGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5925Mimulus unigene:MlU2313Phytome id:
 Oryza sativa homolog:Os03g04410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGTTCAACCCCGATTACCOvergo seq fw:
Reverse primer:TGGAACTGACAGCCACACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5927Mimulus unigene:MlU2335Phytome id:
 Oryza sativa homolog:Os07g22220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACTAACGAAGCATCAAGAGCOvergo seq fw:
Reverse primer:CTTCAAATATTCCACCAGTTCCOvergo seq rv:
Tm:57.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5928Mimulus unigene:MlU2350Phytome id:
 Oryza sativa homolog:Os12g01530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGATGTCGCCCTGAAAGGOvergo seq fw:
Reverse primer:TGATCAGGTTTCTCAACTTGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5929Mimulus unigene:MlU2367Phytome id:
 Oryza sativa homolog:Os10g33250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAGGAAACTGTGAGAATGGOvergo seq fw:
Reverse primer:TCGACGGGAGTAGTTTAGTGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5930Mimulus unigene:MlU2395Phytome id:
 Oryza sativa homolog:Os11g36030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAAATTGACCACGAACACCOvergo seq fw:
Reverse primer:GGTACAACATGCCATCAGTGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5931Mimulus unigene:MlU2401Phytome id:
 Oryza sativa homolog:Os05g51670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATCTTCACCGATGTAGCCOvergo seq fw:
Reverse primer:TAAAAGCAGTCGGGGAAAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5932Mimulus unigene:MlU2406Phytome id:
 Oryza sativa homolog:Os08g28970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGTGTACGAAATACCTTGCOvergo seq fw:
Reverse primer:AACATAACTGCAGCGACAGCOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5933Mimulus unigene:MlU2447Phytome id:
 Oryza sativa homolog:Os12g38380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACAAACGTTGCCAATGAGGOvergo seq fw:
Reverse primer:GCAGATAGGGGTGTTTTAGGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5934Mimulus unigene:MlU2449Phytome id:
 Oryza sativa homolog:Os03g01810
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCAACACTCTTCTCCAAAGCOvergo seq fw:
Reverse primer:AAGAATCGGTTCAGGAGTGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5935Mimulus unigene:MlU2467Phytome id:
 Oryza sativa homolog:Os06g48750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTTGATGCGAAAATGAACGOvergo seq fw:
Reverse primer:CGGTACCAGACTGAGCTTGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5936Mimulus unigene:MlU2471Phytome id:
 Oryza sativa homolog:Os12g12360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACAGCGTTTTCACTTTGCOvergo seq fw:
Reverse primer:TCTCCGATGCCAACATCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5937Mimulus unigene:MlU2506Phytome id:
 Oryza sativa homolog:Os08g44430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCTTCAGGGTGTTCCATGCOvergo seq fw:
Reverse primer:TCAGCGGAAACTTCAATTCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5938Mimulus unigene:MlU2515Phytome id:
 Oryza sativa homolog:Os09g10850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGCTATCAAGTTGTTATTTCGOvergo seq fw:
Reverse primer:GCAATTGAAGTGGCTCATGCOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5939Mimulus unigene:MlU2556Phytome id:
 Oryza sativa homolog:Os12g40510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGGTAGTTGCCACTCTTGCOvergo seq fw:
Reverse primer:CCTCAACTCTTGAATGAAAAACGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5940Mimulus unigene:MlU2581Phytome id:
 Oryza sativa homolog:Os02g32690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGCCATTTTACAGTCTGCOvergo seq fw:
Reverse primer:CTTCCTTTCTCCGAATACCGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5941Mimulus unigene:MlU2600Phytome id:
 Oryza sativa homolog:Os12g39070
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATAGCTTCCTGGACATTCGOvergo seq fw:
Reverse primer:TTGCTCGCAGACTACAGAGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5942Mimulus unigene:MlU2606Phytome id:
 Oryza sativa homolog:Os04g33830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTTCCACTTTGTCTTCTCCOvergo seq fw:
Reverse primer:GTGGAGTGGGGAAGTGAGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5943Mimulus unigene:MlU2622Phytome id:
 Oryza sativa homolog:Os02g14780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGACTATGTTGCGGTCTGAGGOvergo seq fw:
Reverse primer:GGACCTGAATTCGAAAGTCGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5945Mimulus unigene:MlU2668Phytome id:
 Oryza sativa homolog:Os10g30580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCATCATCTTCCTCCATCGOvergo seq fw:
Reverse primer:GCACTCGCTAAATACACTCAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5946Mimulus unigene:MlU2682Phytome id:
 Oryza sativa homolog:Os10g14870
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTCTTTGGGTTTCTTATCGOvergo seq fw:
Reverse primer:GCCAACAAGTTGACTGTGACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5947Mimulus unigene:MlU2683Phytome id:
 Oryza sativa homolog:Os03g51600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCGAAGTTGGGCTTCACCOvergo seq fw:
Reverse primer:ATGCAGTGTTGGTGATTTCGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5948Mimulus unigene:MlU2710Phytome id:
 Oryza sativa homolog:Os11g26850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGGCTTCCAAGTCCTAACCOvergo seq fw:
Reverse primer:GCAAAACGTAAACCTCCTTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5949Mimulus unigene:MlU2729Phytome id:
 Oryza sativa homolog:Os03g21800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGCATCTTCCTCTCTTTCGOvergo seq fw:
Reverse primer:ATTAGCAAATCGACAGTCAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5950Mimulus unigene:MlU2743Phytome id:
 Oryza sativa homolog:Os12g03500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATATCCTTGGGCACCTCTCCOvergo seq fw:
Reverse primer:GAGTTCGCTCAAGCATACGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5951Mimulus unigene:MlU2766Phytome id:
 Oryza sativa homolog:Os04g32680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGGTCATGAATCCGATGGOvergo seq fw:
Reverse primer:ACGTCTACTGCGATCCTTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5952Mimulus unigene:MlU2808Phytome id:
 Oryza sativa homolog:Os05g14170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATTCTAACCCAGCAGAACCOvergo seq fw:
Reverse primer:TCCTTACATGCCAGAGATTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5953Mimulus unigene:MlU2815Phytome id:
 Oryza sativa homolog:Os01g15260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGCCGTTATCAAGAATGCOvergo seq fw:
Reverse primer:TTCGTGGGTGACATAACTTCCOvergo seq rv:
Tm:57.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5954Mimulus unigene:MlU2821Phytome id:
 Oryza sativa homolog:Os07g37650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTAGATGAAACCGACGATGCOvergo seq fw:
Reverse primer:GGGGCTCCTAAAGTTCTTGCOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5955Mimulus unigene:MlU2905Phytome id:
 Oryza sativa homolog:Os07g47820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACGAGCCTTTTTGTTTCCOvergo seq fw:
Reverse primer:TGCCAAGTGTCGGATAGAGCOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5956Mimulus unigene:MlU2926Phytome id:
 Oryza sativa homolog:Os04g30730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCGCGCGAGTCTTCTTAGGOvergo seq fw:
Reverse primer:GCTGGAGGATTTGAAGAAGGOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5957Mimulus unigene:MlU2942Phytome id:
 Oryza sativa homolog:Os01g43700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGTATACGAAGGCGAGAGCOvergo seq fw:
Reverse primer:GAAGGGTGAGCGAAGAAACCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5958Mimulus unigene:MlU2963Phytome id:
 Oryza sativa homolog:Os06g46310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATTGCTATTCAGATTTTGAGCOvergo seq fw:
Reverse primer:GGCGAATGGTTCTTGAGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5959Mimulus unigene:MlU2975Phytome id:
 Oryza sativa homolog:Os07g01850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGGAAATATTGCTGTGTGCOvergo seq fw:
Reverse primer:TGGTCTGCAAGGAGCTAAGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5960Mimulus unigene:MlU2980Phytome id:
 Oryza sativa homolog:Os08g06470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGAAGTGCTAAATGGAGACCOvergo seq fw:
Reverse primer:GAGTACTTCTCCATCCTCTTCTCGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5961Mimulus unigene:MlU3014Phytome id:
 Oryza sativa homolog:Os02g03410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAAGCCGACCCTAATTTCGOvergo seq fw:
Reverse primer:TGAACTGTTCTCGGAGATAGGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5962Mimulus unigene:MlU3021Phytome id:
 Oryza sativa homolog:Os08g39140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGACTTATCGTTCTTGTCGOvergo seq fw:
Reverse primer:GCTCGTGTCTGCTACAAAGGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5963Mimulus unigene:MlU3028Phytome id:
 Oryza sativa homolog:Os08g08190
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGGCTACCTCGGAACTTGCOvergo seq fw:TCCGACTCATCAGGAAGCTAAAGA
Reverse primer:CAACGGCAGTCTCAGAAGCOvergo seq rv: AAGTTCCGAGGTAGCCTCTTTAGC
Tm:61.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5964Mimulus unigene:MlU3033Phytome id:
 Oryza sativa homolog:Os05g41640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATAGTCGTCACCCCTTTCCOvergo seq fw:
Reverse primer:CCAACCGATGTCGTTATTGCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5965Mimulus unigene:MlU3034Phytome id:
 Oryza sativa homolog:Os02g03750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCCGTTATCGAGTTAATGCOvergo seq fw:
Reverse primer:CAATTTTTCGGATCCTCTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5967Mimulus unigene:MlU3061Phytome id:
 Oryza sativa homolog:Os11g08330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATTGTAACTTGGCTTGTTCCOvergo seq fw:
Reverse primer:TCTATGCACACACTGCAAAGGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5968Mimulus unigene:MlU3069Phytome id:
 Oryza sativa homolog:Os01g51754
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTTCAGGAAACGAAATCCOvergo seq fw:
Reverse primer:CTCTTGGCATGTAGCCTTCGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5969Mimulus unigene:MlU3072Phytome id:
 Oryza sativa homolog:Os03g50320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTCGCTCATCTCAGGATGGOvergo seq fw:
Reverse primer:TTGCTTCAACCAAAAGATCGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5970Mimulus unigene:MlU3078Phytome id:
 Oryza sativa homolog:Os05g09490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCATAACAAAGGGGAAGCOvergo seq fw:
Reverse primer:GACATAGGTACGAGGGTTTGGOvergo seq rv:
Tm:57.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5971Mimulus unigene:MlU3086Phytome id:
 Oryza sativa homolog:Os08g09350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTGAAGGCATCAGAGTCCOvergo seq fw:
Reverse primer:AGAGTCTCCCTCCCTACAGCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5972Mimulus unigene:MlU3088Phytome id:
 Oryza sativa homolog:Os03g57790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGATGGAAGTATTTGCTTGGOvergo seq fw:
Reverse primer:GTTTGCTGGCGAATTTGGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5973Mimulus unigene:MlU3090Phytome id:
 Oryza sativa homolog:Os09g33600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTGTCAACGGCTTCTGGOvergo seq fw:
Reverse primer:AGGGGTAGAATTGGGATTGCOvergo seq rv:
Tm:61.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5974Mimulus unigene:MlU3122Phytome id:
 Oryza sativa homolog:Os05g34180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGCGTGTTTCTGTTTAACTCGOvergo seq fw:
Reverse primer:ACACCAACGGAAATGTCACCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5975Mimulus unigene:MlU3123Phytome id:
 Oryza sativa homolog:Os02g17970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCCGTTGAAAAGACTGAGGOvergo seq fw:
Reverse primer:TTATGATCATCCCGTGAAAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5976Mimulus unigene:MlU3136Phytome id:
 Oryza sativa homolog:Os07g09720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACACTTGAAGGAGCCACTGCOvergo seq fw:
Reverse primer:AGCTTTTCTCCACCAACACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5977Mimulus unigene:MlU3137Phytome id:
 Oryza sativa homolog:Os07g09720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCCTCACCACAGAATCAGCOvergo seq fw:
Reverse primer:TTTGGTGGAGGCTATCTTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5978Mimulus unigene:MlU3149Phytome id:
 Oryza sativa homolog:Os06g29350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCATTGATTTGGAAAGATCGOvergo seq fw:
Reverse primer:AGAAGCCAAAGAAGACACTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5979Mimulus unigene:MlU3167Phytome id:
 Oryza sativa homolog:Os05g47490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGACGTTGGTGTCGTATCCOvergo seq fw:
Reverse primer:GCAAAAAGGGGGAAGTATCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5980Mimulus unigene:MlU3169Phytome id:
 Oryza sativa homolog:Os05g28710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCATAGAGAGAGAATCTTCAATAGACCOvergo seq fw:
Reverse primer:CCTATGCAAGTGGAAGATGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5981Mimulus unigene:MlU3175Phytome id:
 Oryza sativa homolog:Os08g19320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGAGAGAAGCTGGAAAGTCAGCOvergo seq fw:
Reverse primer:CCAACTCTATATACCGGTTTGCOvergo seq rv:
Tm:62.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5982Mimulus unigene:MlU3180Phytome id:
 Oryza sativa homolog:Os03g04600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGCACTTCTTCTTTTGAACCOvergo seq fw:
Reverse primer:GGCTGCGATAATTGTGAAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5983Mimulus unigene:MlU3183Phytome id:
 Oryza sativa homolog:Os04g32600
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGATCGATTCCGACTCTGCOvergo seq fw:AACTGTTGAGAGATCGATTCCGAC
Reverse primer:TGTTGGGCATATTTGAATGCOvergo seq rv: ATGGCGATGGTGCAGAGTCGGAAT
Tm:57.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5984Mimulus unigene:MlU3202Phytome id:
 Oryza sativa homolog:Os02g27360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAAGTTCACCACAAGTACGGOvergo seq fw:
Reverse primer:TGGAGGAGGCCTTTATATCGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5985Mimulus unigene:MlU3203Phytome id:
 Oryza sativa homolog:Os04g26834
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAATAAGCATTTCCACTCGOvergo seq fw:
Reverse primer:TGGTAGCGAATTGACTTTATTAGGOvergo seq rv:
Tm:57.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5986Mimulus unigene:MlU3218Phytome id:
 Oryza sativa homolog:Os07g47290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGTTCTTCCCAGGTGTTCCOvergo seq fw:
Reverse primer:CAAGGCCAAACCTTTGTAGGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5987Mimulus unigene:MlU3219Phytome id:
 Oryza sativa homolog:Os07g47290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAGCGTCTCAAAATCAGCOvergo seq fw:
Reverse primer:ACCGGGAGGATTTAATTTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5988Mimulus unigene:MlU3222Phytome id:
 Oryza sativa homolog:Os01g66560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGCTTGCATTGTGAGAGGOvergo seq fw:
Reverse primer:GTACCCGAAAGGGTTTGACCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5989Mimulus unigene:MlU3254Phytome id:
 Oryza sativa homolog:Os09g02810
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAATTGCTGCATTCTCAAAGCOvergo seq fw:
Reverse primer:TCAGCAGTCACATTTTGAAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5990Mimulus unigene:MlU3271Phytome id:
 Oryza sativa homolog:Os05g38150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCACCGTTCACCACTTGCOvergo seq fw:
Reverse primer:GTTGCAGAGGCCTTTTTACGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5991Mimulus unigene:MlU3296Phytome id:
 Oryza sativa homolog:Os07g06820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGTCTCCAGTGTCCTTCCOvergo seq fw:
Reverse primer:TTTGTGCAGTCGTTCATTCCOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5992Mimulus unigene:MlU3303Phytome id:
 Oryza sativa homolog:Os07g41090
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAAACTATCAATGTCGGAAAGGOvergo seq fw:
Reverse primer:TTCCAATTCTCACAATGACGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5993Mimulus unigene:MlU3320Phytome id:
 Oryza sativa homolog:Os05g32850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGGACCCTCTCAATGTCGOvergo seq fw:
Reverse primer:AGAATACCTCCGGCTATTGTGGOvergo seq rv:
Tm:62.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5994Mimulus unigene:MlU3352Phytome id:
 Oryza sativa homolog:Os03g14260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATTTTAGTAGAGCTGTAGCTGACGOvergo seq fw:
Reverse primer:AATTTTCCCCATCATTTAATTCCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5995Mimulus unigene:MlU3358Phytome id:
 Oryza sativa homolog:Os04g54810
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCGATTGTGGAGCTTTCCOvergo seq fw:
Reverse primer:GATACACCGTTGGGACATACGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5996Mimulus unigene:MlU3383Phytome id:
 Oryza sativa homolog:Os01g66980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGATCAGCTCCACCAGTTCCOvergo seq fw:
Reverse primer:CACCCAGAATTTGCAGAAGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5997Mimulus unigene:MlU3393Phytome id:
 Oryza sativa homolog:Os03g49940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGTGATCAAGGAAATAAACGOvergo seq fw:
Reverse primer:CCGATCCAGCATACTTCTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5998Mimulus unigene:MlU3419Phytome id:
 Oryza sativa homolog:Os05g48240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGACAATAAACGATGGACTTGGOvergo seq fw:
Reverse primer:AGAGTGGAGGTTGGAAATGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5999Mimulus unigene:MlU3423Phytome id:
 Oryza sativa homolog:Os07g09400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAACACCCGTTATTGAGATGGOvergo seq fw:
Reverse primer:AAAGCACATTTGACCCTTGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6000Mimulus unigene:MlU3443Phytome id:
 Oryza sativa homolog:Os11g39650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTACGGCGTCCCACTCTACGOvergo seq fw:
Reverse primer:TTTGGGAAATGAACAAATAACGOvergo seq rv:
Tm:62.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6001Mimulus unigene:MlU3444Phytome id:
 Oryza sativa homolog:Os11g39650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGCATAATATACAGCGAACGOvergo seq fw:
Reverse primer:CGTGTCACCTGATGGAAAGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6002Mimulus unigene:MlU3451Phytome id:
 Oryza sativa homolog:Os11g05160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGCTCCCAACTACAATCTGGOvergo seq fw:
Reverse primer:GCTGATGGCCGTGTAATAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6003Mimulus unigene:MlU3457Phytome id:
 Oryza sativa homolog:Os09g39462
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGCATACCATGGTTCAGGOvergo seq fw:
Reverse primer:GCGGGAAACTTACTCTCTGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS6004Mimulus unigene:MlU3485Phytome id:
 Oryza sativa homolog:Os07g08400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTAAAGGGGCAAGATGTGGOvergo seq fw:
Reverse primer:ATTTGCTGCACCGACTTTCCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6005Mimulus unigene:MlU3490Phytome id:
 Oryza sativa homolog:Os01g59660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTAAAAGCTGCCGATTACGOvergo seq fw:
Reverse primer:AGGAGCGAAACCATTACTCGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6006Mimulus unigene:MlU3493Phytome id:
 Oryza sativa homolog:Os04g02050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGGACACATAAATCCATCGOvergo seq fw:
Reverse primer:TGCAAAGGCTAGAATCAATGCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS6007Mimulus unigene:MlU3500Phytome id:
 Oryza sativa homolog:Os02g43020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAACGAAGTCCTCAAATCTGGOvergo seq fw:
Reverse primer:TATCCTGCATCATTTTGACGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS6008Mimulus unigene:MlU3518Phytome id:
 Oryza sativa homolog:Os03g02440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAGGATGGATGTTTTACGOvergo seq fw:
Reverse primer:TGGATATATCTCGGGCTTACGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS6009Mimulus unigene:MlU3523Phytome id:
 Oryza sativa homolog:Os04g52200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACAGTGAGGGTAGTGTTGATGGOvergo seq fw:
Reverse primer:CAGCAGATTCTGGGAGTGCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6010Mimulus unigene:MlU3533Phytome id:
 Oryza sativa homolog:Os08g23360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGAGGAAGGCAATGAAATGGOvergo seq fw:
Reverse primer:CCCCATATTTCCCAAGTTCCOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS6011Mimulus unigene:MlU3539Phytome id:
 Oryza sativa homolog:Os09g35960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCTTCTGGCTAAACAATGGOvergo seq fw:
Reverse primer:AAGGAATGGCCAGACTTCGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS6012Mimulus unigene:MlU3553Phytome id:
 Oryza sativa homolog:Os01g03660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTTATGCCCAAAATCAGCOvergo seq fw:
Reverse primer:GATTTTGCCCATTCCTAACGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS6013Mimulus unigene:MlU3567Phytome id:
 Oryza sativa homolog:Os08g07010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACGTGCTGCACATAGAACCOvergo seq fw:
Reverse primer:TCCTACTTCATGGCCCTAACCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):