Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1600 - 1699) out of 1979 markers

MlSTS5804Mimulus unigene:MlU10040Phytome id:
 Arabidopsis homolog:At2g38280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCTGCCCAGAAAGAAGTGCOvergo seq fw:
Reverse primer:GCATGTCCACATTGAGATCGOvergo seq rv:
Tm:62.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5805Mimulus unigene:MlU10044Phytome id:
 Arabidopsis homolog:At5g54910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATCGTATCCTGGACCTTGGOvergo seq fw:
Reverse primer:TTTTACGCTGTTTCATCTTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5806Mimulus unigene:MlU10111Phytome id:
 Arabidopsis homolog:At3g59380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGCGATCGAGATGAACGOvergo seq fw:
Reverse primer:ATTCTTCAGAGGGGTCATCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5807Mimulus unigene:MlU10299Phytome id:
 Arabidopsis homolog:At5g66760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACATACGATGCTGTTGTCGOvergo seq fw:
Reverse primer:CAGCTCAATGACAGCTTTGGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5808Mimulus unigene:MlU10371Phytome id:
 Arabidopsis homolog:At5g08690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTACCCCCAATCTTGAATGCOvergo seq fw:
Reverse primer:CTTTCATCGATTGGCTCACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5809Mimulus unigene:MlU10442Phytome id:
 Arabidopsis homolog:At5g17310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATACGATCACCGTGGTTGGOvergo seq fw:
Reverse primer:GCAATCGGCATAAACGTACCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5810Mimulus unigene:MlU14Phytome id:
 Oryza sativa homolog:Os12g07590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAAGTGAAAGTGTTTAACAATCCOvergo seq fw:
Reverse primer:GATAGTTGTGGAAAATATTGATAATGCOvergo seq rv:
Tm:57.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5811Mimulus unigene:MlU22Phytome id:
 Oryza sativa homolog:Os04g32680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCGTTCAGTTCCACACCOvergo seq fw:
Reverse primer:CCCACCTTGGTCATAAATCCOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5812Mimulus unigene:MlU39Phytome id:
 Oryza sativa homolog:Os03g37640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTTTTCCCAATTGGTACGGOvergo seq fw:
Reverse primer:GTGTGGCTGTTGGATGTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5813Mimulus unigene:MlU87Phytome id:
 Oryza sativa homolog:Os01g52500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAACAAAAGCCCATACTGCOvergo seq fw:
Reverse primer:TTAAGGGAACGTCAGATAATGGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5814Mimulus unigene:MlU106Phytome id:
 Oryza sativa homolog:Os06g46310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATATCAGCCCCAATCAGTGCOvergo seq fw:
Reverse primer:CATGAGCATAGCGTTCTTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5815Mimulus unigene:MlU117Phytome id:
 Oryza sativa homolog:Os04g24180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCATCACAAGCCTAGAACCOvergo seq fw:
Reverse primer:TGTGACAATGCAGGCTTGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5816Mimulus unigene:MlU120Phytome id:
 Oryza sativa homolog:Os02g22780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCTCACGGTAACAATGTCGOvergo seq fw:
Reverse primer:CAGACAGTTGGGTGCTTGGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5817Mimulus unigene:MlU130Phytome id:
 Oryza sativa homolog:Os03g50130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGACGTCGCTTCTCAGGOvergo seq fw:
Reverse primer:TGTAGTGCTTGTTGCTGTTGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5818Mimulus unigene:MlU151Phytome id:
 Oryza sativa homolog:Os08g43130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGTGATCATGGATTTGTACCOvergo seq fw:
Reverse primer:CCTTGTTGAATCTGGCTTCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5819Mimulus unigene:MlU287Phytome id:
 Oryza sativa homolog:Os11g32260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGGCGAGTTCGACTACCOvergo seq fw:
Reverse primer:GGATTTATCTGTCATGGCAACCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5820Mimulus unigene:MlU302Phytome id:
 Oryza sativa homolog:Os11g05110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTGATGGTGTCATGGTTGCOvergo seq fw:
Reverse primer:CAATGGATAGGAGCCTTTGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5821Mimulus unigene:MlU320Phytome id:
 Oryza sativa homolog:Os04g58630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACCAACACTCTCAGAAGCOvergo seq fw:
Reverse primer:CAAATGCCTGCTGGTAAACGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5822Mimulus unigene:MlU325Phytome id:
 Oryza sativa homolog:Os03g46390
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGATCTTGCAAACAAACGOvergo seq fw:
Reverse primer:TCGTTATTCAGCGTCAGTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5823Mimulus unigene:MlU351Phytome id:
 Oryza sativa homolog:Os01g62890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCTTTCAGGTTTGGTGTCCOvergo seq fw:
Reverse primer:TCTAGCTGCCAAAATGAGACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5824Mimulus unigene:MlU383Phytome id:
 Oryza sativa homolog:Os01g01920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATGCCTTTTCATGTTTCCOvergo seq fw:
Reverse primer:TCAGCTTCGCATAATAGATTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5825Mimulus unigene:MlU468Phytome id:
 Oryza sativa homolog:Os04g39880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTACAGCGGAGCAGAAAAGGOvergo seq fw:
Reverse primer:CTTCAGGGACAATGAACAACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5826Mimulus unigene:MlU471Phytome id:
 Oryza sativa homolog:Os10g41960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCTCTGGCGTCAGTTGGOvergo seq fw:
Reverse primer:CGTACTCTTGTTCCTTGTCAGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5827Mimulus unigene:MlU512Phytome id:
 Oryza sativa homolog:Os07g32400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGTTCTCTTAACCATGGAAGGOvergo seq fw:
Reverse primer:GCCATCCAATAAGGCGTACCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5828Mimulus unigene:MlU527Phytome id:
 Oryza sativa homolog:Os10g33720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGCTGATTTTGGGTATTCGOvergo seq fw:
Reverse primer:ATGTACTGTGCCGATCAAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5831Mimulus unigene:MlU607Phytome id:
 Oryza sativa homolog:Os05g05470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCCAGACTTGGTGTACAGGOvergo seq fw:
Reverse primer:AAGTACCCTTCAAAGAAGACATCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5832Mimulus unigene:MlU633Phytome id:
 Oryza sativa homolog:Os11g28340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCCGCTATCCAAGTTATCCOvergo seq fw:
Reverse primer:GGCAATATGTGTTTCTTCTTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5833Mimulus unigene:MlU638Phytome id:
 Oryza sativa homolog:Os05g47490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCCAATGCGCTTGTTGCOvergo seq fw:
Reverse primer:CGGACAAAAGCAGAGAGTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5834Mimulus unigene:MlU655Phytome id:
 Oryza sativa homolog:Os10g31000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTTTAGTGGGTCCGATGGOvergo seq fw:
Reverse primer:GCTTATCCTTACAAATCTCCTTCCOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5835Mimulus unigene:MlU659Phytome id:
 Oryza sativa homolog:Os03g51230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATGTGACGGTAAAGTAGTCGOvergo seq fw:
Reverse primer:CGTATGAAAAACCACCACTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5836Mimulus unigene:MlU674Phytome id:
 Oryza sativa homolog:Os07g42834
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTCTTGATCCCGCATGGOvergo seq fw:
Reverse primer:AAGTTCCTCCCCGATCTCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5837Mimulus unigene:MlU676Phytome id:
 Oryza sativa homolog:Os01g52690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCTGGCTCGTTGTGTAAGGOvergo seq fw:
Reverse primer:CACAACTCCCATTGTGAATCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5838Mimulus unigene:MlU705Phytome id:
 Oryza sativa homolog:Os02g07260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCATCTTGACCTCAACTCCOvergo seq fw:
Reverse primer:CGTGAGAGTGGATCTGAACGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5839Mimulus unigene:MlU708Phytome id:
 Oryza sativa homolog:Os02g57250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAACAAGCATCCAATCTCCOvergo seq fw:
Reverse primer:TGCAAATGAAAAAGGATTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5840Mimulus unigene:MlU734Phytome id:
 Oryza sativa homolog:Os06g02510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCACCAGCCTTGAACTTGCOvergo seq fw:
Reverse primer:GATCTTCCCCAGACCTACTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5841Mimulus unigene:MlU766Phytome id:
 Oryza sativa homolog:Os07g48290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCACCTGAAACACCTTCCOvergo seq fw:
Reverse primer:CGATTTCTCCGACTTCTTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5842Mimulus unigene:MlU770Phytome id:
 Oryza sativa homolog:Os04g39150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGAAGATAAGCATCCAAATCCOvergo seq fw:
Reverse primer:CAAAGCCAGTCTTAGTGTGACGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5843Mimulus unigene:MlU791Phytome id:
 Oryza sativa homolog:Os11g01340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGGACATTTTCTCCACTCCOvergo seq fw:
Reverse primer:TCTGGTGGTGTGTTCTGTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5844Mimulus unigene:MlU797Phytome id:
 Oryza sativa homolog:Os01g59530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGGAAGTCATCATTGTAACGOvergo seq fw:
Reverse primer:TGTTTGACAAAGATGGAGATGGOvergo seq rv:
Tm:57.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5845Mimulus unigene:MlU831Phytome id:
 Oryza sativa homolog:Os06g02380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGTCGTTGTCAAGAGTTGCOvergo seq fw:
Reverse primer:GGTGGCAGACCAAGAATACGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5846Mimulus unigene:MlU872Phytome id:
 Oryza sativa homolog:Os02g27769
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACATAACCACCGTCTTCAGCOvergo seq fw:
Reverse primer:CTGGCAAAGCACAGTCTGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5847Mimulus unigene:MlU882Phytome id:
 Oryza sativa homolog:Os03g54890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGAGGCCTGTGCTCTCTCCOvergo seq fw:
Reverse primer:GAACACTAAGCCCTCTCATGGOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5848Mimulus unigene:MlU891Phytome id:
 Oryza sativa homolog:Os07g01150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACTGTGAGTCTCGATAGCCOvergo seq fw:
Reverse primer:ACGAACAAGCTTACCGTTGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5849Mimulus unigene:MlU900Phytome id:
 Oryza sativa homolog:Os01g66110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAACGATTCACACCAGTCGOvergo seq fw:
Reverse primer:GGATATGCGAGCTGTTTATGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5850Mimulus unigene:MlU921Phytome id:
 Oryza sativa homolog:Os06g40640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGAACACCGAGGAGAATCGOvergo seq fw:
Reverse primer:CAACAATTGGCACCAGACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5851Mimulus unigene:MlU984Phytome id:
 Oryza sativa homolog:Os03g61710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCAGTTGGACATTTGTAGCOvergo seq fw:
Reverse primer:CACTGGTTGCTGCTTTTGCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5852Mimulus unigene:MlU992Phytome id:
 Oryza sativa homolog:Os03g27310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGCTCGTACAAAGCAGACCOvergo seq fw:
Reverse primer:AACAAGCCGACCAAGTAAGCOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5853Mimulus unigene:MlU1000Phytome id:
 Oryza sativa homolog:Os08g18044
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGACTTCTTTCCTCAGACGOvergo seq fw:
Reverse primer:TCTTGATCAGCGTCCAAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5854Mimulus unigene:MlU1030Phytome id:
 Oryza sativa homolog:Os02g33110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCACTTACTTCCGTGATCCOvergo seq fw:
Reverse primer:AAGGACATACGAACCCAACGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5855Mimulus unigene:MlU1031Phytome id:
 Oryza sativa homolog:Os03g50730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGCCAAGCTGTATTGAAGCOvergo seq fw:
Reverse primer:CACTCCAGAAGAGAGAGTCAAGGOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5856Mimulus unigene:MlU1051Phytome id:
 Oryza sativa homolog:Os02g54990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGGATTGTTGTTCTTTACTGCOvergo seq fw:
Reverse primer:ATTGATGCCTGAAGGAGACCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5857Mimulus unigene:MlU1088Phytome id:
 Oryza sativa homolog:Os02g01940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCGACTTCGTCGATGGOvergo seq fw:
Reverse primer:CTGCACAAAAGTTGCACTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5858Mimulus unigene:MlU1130Phytome id:
 Oryza sativa homolog:Os02g47400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTAAGGTCGTCGTCAATCCOvergo seq fw:
Reverse primer:CACATATAGGGGCGCAAGGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5859Mimulus unigene:MlU1135Phytome id:
 Oryza sativa homolog:Os01g54340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGTAACCGCATTTTCTCCOvergo seq fw:
Reverse primer:TGAATTTCCGTGAAGAGTTCGOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5860Mimulus unigene:MlU1151Phytome id:
 Oryza sativa homolog:Os04g52960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAAGTGAGCCAGAAAAAGGOvergo seq fw:
Reverse primer:GTCTTTTCAAAGGGGGAAGCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5861Mimulus unigene:MlU1164Phytome id:
 Oryza sativa homolog:Os03g60090
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCCTTCTGGTAGACATATCCOvergo seq fw:
Reverse primer:AGCCAACCAGCTGTTAATGGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5862Mimulus unigene:MlU1204Phytome id:
 Oryza sativa homolog:Os04g52900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATCCAGAAGCCTTTCGOvergo seq fw:
Reverse primer:CAAACCAGAGGCAGAATGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5863Mimulus unigene:MlU1249Phytome id:
 Oryza sativa homolog:Os08g37456
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATCCCAATTGCTTGATCGOvergo seq fw:
Reverse primer:GAAGCGAGTTTGGAGTATTTCGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5864Mimulus unigene:MlU1282Phytome id:
 Oryza sativa homolog:Os07g12110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACTACGGGAATGCGAAGCOvergo seq fw:
Reverse primer:GGTTGCTCAAGAAGAAATCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5865Mimulus unigene:MlU1284Phytome id:
 Oryza sativa homolog:Os03g51250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGTGAGTATTGAGAAAACAGATGGOvergo seq fw:
Reverse primer:TTGCTCTGGAATAAAACACTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5866Mimulus unigene:MlU1291Phytome id:
 Oryza sativa homolog:Os05g02650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCATTCAATCGTCCAGAACCOvergo seq fw:
Reverse primer:AACTTCATGTATCCCGTATAAGAGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5867Mimulus unigene:MlU1296Phytome id:
 Oryza sativa homolog:Os02g48740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCCAGAACATGATGCTTGCOvergo seq fw:
Reverse primer:GGGACTTTCTTTCTTGAACTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5868Mimulus unigene:MlU1319Phytome id:
 Oryza sativa homolog:Os06g40640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGGAGGGAGGTGTTCTCCOvergo seq fw:
Reverse primer:AGTACTGCTGGCACCTCTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5869Mimulus unigene:MlU1330Phytome id:
 Oryza sativa homolog:Os09g34010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAACCTTTTTGGCCTTAGCOvergo seq fw:
Reverse primer:CTACAGAAGCGACGAGAAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5870Mimulus unigene:MlU1344Phytome id:
 Oryza sativa homolog:Os03g53660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCAGCTTTTCAACCACACCOvergo seq fw:
Reverse primer:TTCATCAACCATTGCTCTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5871Mimulus unigene:MlU1369Phytome id:
 Oryza sativa homolog:Os08g39140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGTTTTGTCATTTTTATCAGCOvergo seq fw:
Reverse primer:GTTGGTCAGCGAACATGGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5872Mimulus unigene:MlU1371Phytome id:
 Oryza sativa homolog:Os03g56190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATGTGCAAGTATGGGTATGCOvergo seq fw:
Reverse primer:TCGACGAAGCTGCTGAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5873Mimulus unigene:MlU1396Phytome id:
 Oryza sativa homolog:Os12g41140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTTTCAACGCAAAATATCGOvergo seq fw:
Reverse primer:AAAACTTCCTCGGAATTTGTAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5874Mimulus unigene:MlU1401Phytome id:
 Oryza sativa homolog:Os04g42430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACTCTTCAACTTCATTCTTCTCCOvergo seq fw:
Reverse primer:CGTTCTGAGCAAAAGTTTATTCCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5875Mimulus unigene:MlU1402Phytome id:
 Oryza sativa homolog:Os12g38920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACGGGGGCTAAGATAACCOvergo seq fw:
Reverse primer:CGAGATCCGAAGAAAAGTATCGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5876Mimulus unigene:MlU1404Phytome id:
 Oryza sativa homolog:Os01g59530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTCAATCCTTTGTTTTCGOvergo seq fw:
Reverse primer:GGAGCTCGGGACTGTAATGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5877Mimulus unigene:MlU1415Phytome id:
 Oryza sativa homolog:Os01g24060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAGAATCTAATCTGCTCTGGOvergo seq fw:
Reverse primer:CGTGTCTTCAACAACTTCTTACCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5879Mimulus unigene:MlU1467Phytome id:
 Oryza sativa homolog:Os06g48700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTGGTCGGAAATGAAGTGGOvergo seq fw:
Reverse primer:CTCAATTCCGTTCCAGATGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5880Mimulus unigene:MlU1479Phytome id:
 Oryza sativa homolog:Os08g35740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTCCGGAATAAGCACTCCOvergo seq fw:
Reverse primer:GATTCGATGGTGTTGAGATCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5881Mimulus unigene:MlU1481Phytome id:
 Oryza sativa homolog:Os02g27110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCAGAAGAAACGAAGAGAAGCOvergo seq fw:
Reverse primer:TCAGTGGCAGCATAAATTCCOvergo seq rv:
Tm:57.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5882Mimulus unigene:MlU1496Phytome id:
 Oryza sativa homolog:Os03g60880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTCTATACTGCCTCTTCTTCGOvergo seq fw:
Reverse primer:TTGTCCCACCAATGTTTGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5883Mimulus unigene:MlU1503Phytome id:
 Oryza sativa homolog:Os04g39440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTTTGCAGTGTTAATGAAAGCOvergo seq fw:
Reverse primer:ATTTGCCAGGGAACATGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5884Mimulus unigene:MlU1521Phytome id:
 Oryza sativa homolog:Os12g19470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGCCTTCGGGCTTGTATGCOvergo seq fw:
Reverse primer:CGACGACATCACTTCTCTCGOvergo seq rv:
Tm:62.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5885Mimulus unigene:MlU1551Phytome id:
 Oryza sativa homolog:Os01g68324
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGAATGTGGGGATAGAGAGCOvergo seq fw:
Reverse primer:TCCCCGAAACAACAGTTCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5887Mimulus unigene:MlU1583Phytome id:
 Oryza sativa homolog:Os08g40530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGAAGAGGGGGTTTTTGGOvergo seq fw:
Reverse primer:AATTGCAGTCCTCCTTGTCCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5888Mimulus unigene:MlU1600Phytome id:
 Oryza sativa homolog:Os02g52140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTCTAAACCTCGGAACCOvergo seq fw:
Reverse primer:CACCCCAGAGGAAGTACAGCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5889Mimulus unigene:MlU1639Phytome id:
 Oryza sativa homolog:Os09g03939
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGATGAATGATGGGAACCOvergo seq fw:
Reverse primer:CGATCTTTCACAAACATGTCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5890Mimulus unigene:MlU1678Phytome id:
 Oryza sativa homolog:Os05g49890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGGAGGGGCTGACTAGCOvergo seq fw:
Reverse primer:GAGAATATCCCTATTGTTCTTTGTGGOvergo seq rv:
Tm:62.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5893Mimulus unigene:MlU1735Phytome id:
 Oryza sativa homolog:Os03g15560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCGTCCTGAGGAACATAACCOvergo seq fw:
Reverse primer:ACGGTACGCTCCGAAAGCOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5894Mimulus unigene:MlU1738Phytome id:
 Oryza sativa homolog:Os02g07870
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAACGGTAAAACAGATCTCCOvergo seq fw:
Reverse primer:GCAATATTATTCACTTCTACAATTTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5895Mimulus unigene:MlU1754Phytome id:
 Oryza sativa homolog:Os10g17680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGAGCCCGAATACGAGAGCOvergo seq fw:
Reverse primer:GATGTGCGAGGTCGAAGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5896Mimulus unigene:MlU1817Phytome id:
 Oryza sativa homolog:Os03g06940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAAGGCTGACCACAGTTGCOvergo seq fw:
Reverse primer:ACTCTGACCGGTCTCAACGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5897Mimulus unigene:MlU1822Phytome id:
 Oryza sativa homolog:Os05g51510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTTGCTGTTGTTTGTTCGOvergo seq fw:
Reverse primer:CTCGACACTGCAAGAACACCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5898Mimulus unigene:MlU1826Phytome id:
 Oryza sativa homolog:Os08g40530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAAAAGTTCCCAGGTATTCGOvergo seq fw:
Reverse primer:TCAGATTTGGTCCTCAACACCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5899Mimulus unigene:MlU1857Phytome id:
 Oryza sativa homolog:Os08g05670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGTGGTCGCATCTTGCOvergo seq fw:
Reverse primer:TTGGATTGCACTTGAAAAGCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5900Mimulus unigene:MlU1883Phytome id:
 Oryza sativa homolog:Os02g48720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCATTGAATTGCCTCTCACCOvergo seq fw:
Reverse primer:CACTCAGGCTTTGAACTTTGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5901Mimulus unigene:MlU1954Phytome id:
 Oryza sativa homolog:Os07g31370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGCTGTTGTGACTGAGATCCOvergo seq fw:
Reverse primer:TTTCAATAGAGGAGGGAGAGGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5902Mimulus unigene:MlU1959Phytome id:
 Oryza sativa homolog:Os04g54474
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCACAAATCTGACGAGAGCOvergo seq fw:
Reverse primer:GTTGGAGCAACAACGTATGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5903Mimulus unigene:MlU1972Phytome id:
 Oryza sativa homolog:Os05g48240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGACTGAATCAATCTCTGCOvergo seq fw:
Reverse primer:TCAAGTACGTGAGGCAAAGCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5904Mimulus unigene:MlU1991Phytome id:
 Oryza sativa homolog:Os02g50240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGCCTATTAAGGGTGACTGGOvergo seq fw:
Reverse primer:CCTTCTTTCTCCGTGTCTCGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5905Mimulus unigene:MlU1994Phytome id:
 Oryza sativa homolog:Os04g53300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCTGGAACTGGGACAACCOvergo seq fw:
Reverse primer:CGTGGTGGCAGTAGAATAACGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5906Mimulus unigene:MlU2016Phytome id:
 Oryza sativa homolog:Os02g14000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCATCAAGACACAGTACAAAGGOvergo seq fw:
Reverse primer:GGTTTACTGTACATAGCATTGAGTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5907Mimulus unigene:MlU2028Phytome id:
 Oryza sativa homolog:Os03g51459
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCAAAGAACTTTCCACTTCCOvergo seq fw:
Reverse primer:TGGACGAACACAAAACTTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5908Mimulus unigene:MlU2043Phytome id:
 Oryza sativa homolog:Os04g54350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAATTTGAATGCAATTTTGGOvergo seq fw:
Reverse primer:AGGCGTCATTTTACGTCTCCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5909Mimulus unigene:MlU2044Phytome id:
 Oryza sativa homolog:Os12g37400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTAGGACCCTGCTTGCOvergo seq fw:
Reverse primer:TTCAATGCAAGCATCAACGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):