Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1500 - 1599) out of 1979 markers

MlSTS5703Mimulus unigene:MlU4965Phytome id:
 Arabidopsis homolog:At1g08320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCCTTCGAGATTAGCAAGCOvergo seq fw:
Reverse primer:ACGTCTTCCACCTCATCACCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5704Mimulus unigene:MlU4969Phytome id:
 Arabidopsis homolog:At1g63110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTCTTGTAACAGCGCATGGOvergo seq fw:
Reverse primer:CCGGAATGACTAAAACAAAGGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5705Mimulus unigene:MlU4975Phytome id:
 Arabidopsis homolog:At3g55400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTGCAGCCTTCTTTTCGOvergo seq fw:
Reverse primer:GCGCTTTGTAAGTTAGGTTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5706Mimulus unigene:MlU4976Phytome id:
 Arabidopsis homolog:At3g55400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGCAAAAACAGGCACTGGOvergo seq fw:
Reverse primer:GAGGCAGTGCTACAGATTGGOvergo seq rv:
Tm:61.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5707Mimulus unigene:MlU4978Phytome id:
 Arabidopsis homolog:At3g46220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACTCACTGCAGCACTTTGGOvergo seq fw:
Reverse primer:GGACTCTTCTGCATTCATATCGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5708Mimulus unigene:MlU4980Phytome id:
 Arabidopsis homolog:At5g09550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGCAATTAGGTGCAAGCOvergo seq fw:
Reverse primer:CTTTTCCCGTGATTGTGTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5709Mimulus unigene:MlU4981Phytome id:
 Arabidopsis homolog:At5g09550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACTCAAAGTGTGTCGTTGCOvergo seq fw:
Reverse primer:CCAATCCCCGATACAAACGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5710Mimulus unigene:MlU4984Phytome id:
 Arabidopsis homolog:At4g11820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGAAGTTGGAAGCGAAACCOvergo seq fw:
Reverse primer:GATCGGGCTTGTAAAAATCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5711Mimulus unigene:MlU4985Phytome id:
 Arabidopsis homolog:At4g11820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCGTCACAAAGTCCTTTCCOvergo seq fw:
Reverse primer:GCAGCCATCCACACTTATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5712Mimulus unigene:MlU4996Phytome id:
 Arabidopsis homolog:At4g30310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTGGTATGGAAGCTCTTGGOvergo seq fw:
Reverse primer:CAATTTGGTCTTGGAAATAGCCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5713Mimulus unigene:MlU5030Phytome id:
 Arabidopsis homolog:At2g17510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATTATCGCCACAAGAATGCOvergo seq fw:
Reverse primer:CCTTCCTTCTGACCTCTTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5714Mimulus unigene:MlU5034Phytome id:
 Arabidopsis homolog:At5g65750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATTGGATCAGGCTGAGTGGOvergo seq fw:
Reverse primer:AAGTTGATGGAAAGGACATCGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5715Mimulus unigene:MlU5041Phytome id:
 Arabidopsis homolog:At4g14030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCTGGATACCTCATCTCGOvergo seq fw:
Reverse primer:TTGGCTAATTGGCTTCATGGOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5716Mimulus unigene:MlU5048Phytome id:
 Arabidopsis homolog:At1g17290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGTGAGGCGAGAAATAATGGOvergo seq fw:
Reverse primer:GGTGGGAGATGAATCCTACGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5717Mimulus unigene:MlU5050Phytome id:
 Arabidopsis homolog:At5g19050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGTGAATATAAAGCAACTCTCGOvergo seq fw:
Reverse primer:TTCCGGTACGTATTCATCAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5718Mimulus unigene:MlU5051Phytome id:
 Arabidopsis homolog:At5g13450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACATCGCAGCAGTGAAAGCOvergo seq fw:
Reverse primer:TCTCCTCTTCTGCTGGTAAAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5719Mimulus unigene:MlU5055Phytome id:
 Arabidopsis homolog:At2g24120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGGCTTGGTGACTGTGCOvergo seq fw:
Reverse primer:CATATGTGAACCGTCCAACGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5720Mimulus unigene:MlU5058Phytome id:
 Arabidopsis homolog:At3g03920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGAGACGCTGTAACAAAGCOvergo seq fw:
Reverse primer:TCGGAAACCACCTCTTATTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5721Mimulus unigene:MlU5061Phytome id:
 Arabidopsis homolog:At3g60245
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGAAAGTCGGAATTGTCGOvergo seq fw:
Reverse primer:ACAGCCTTCCTCTTCACTGCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5722Mimulus unigene:MlU5066Phytome id:
 Arabidopsis homolog:At5g60360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGGTCTACACCAGCACTACCOvergo seq fw:
Reverse primer:TGCAACTACAGGATACGATGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5723Mimulus unigene:MlU5069Phytome id:
 Arabidopsis homolog:At3g22845
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCCACTGAACATGACCTAGCOvergo seq fw:
Reverse primer:AGCGACGGATGTAGAAAACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5724Mimulus unigene:MlU5070Phytome id:
 Arabidopsis homolog:At1g73030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCCATGGGCAACATCGOvergo seq fw:
Reverse primer:AAACCTCGAGACCGTAATCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5725Mimulus unigene:MlU5078Phytome id:
 Arabidopsis homolog:At1g29250
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTGAAGAACAATGGATTTGCOvergo seq fw:ATTTGATGAATTGATGGCAGCTGC
Reverse primer:CACCATTTCCAGCTCTCTCCOvergo seq rv: AGCTCTCTCCGCTGCAGCAGCTGC
Tm:59.6Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5726Mimulus unigene:MlU5125Phytome id:
 Arabidopsis homolog:At1g55150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAGTGCTTATGTGGAGTGCOvergo seq fw:
Reverse primer:TGTGACTTATCACCATGAATAGCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5727Mimulus unigene:MlU5186Phytome id:
 Arabidopsis homolog:At2g01730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAATGGTTGGCTTTGATGGOvergo seq fw:
Reverse primer:CCTGTGTAGACAAGGGATTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5728Mimulus unigene:MlU5217Phytome id:
 Arabidopsis homolog:At3g20060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATTTCCTGATGGAGATAACCOvergo seq fw:
Reverse primer:CATAAGAATTCAAAGGACTGTCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5729Mimulus unigene:MlU5331Phytome id:
 Arabidopsis homolog:At5g40610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGGCTATGGGGACAATACGOvergo seq fw:
Reverse primer:TTTTGACCGTTCAACATCTCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5730Mimulus unigene:MlU5338Phytome id:
 Arabidopsis homolog:At2g05710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACGGCCTTGGTGTAGTAGGOvergo seq fw:
Reverse primer:TCGATCAGCAATAGAAAGTTGGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5731Mimulus unigene:MlU5416Phytome id:
 Arabidopsis homolog:At1g29940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACGGAACACATATGGAATGGOvergo seq fw:
Reverse primer:TCACTGGTGAGGAGCTAGAGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5732Mimulus unigene:MlU5554Phytome id:
 Arabidopsis homolog:At1g04980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGTGAAAGATGGTTCTGCOvergo seq fw:
Reverse primer:GCTTCTTCTAACTGGGGTTGGOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5733Mimulus unigene:MlU5832Phytome id:
 Arabidopsis homolog:At5g27600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATTTGGCGACGTCTTGTCGOvergo seq fw:
Reverse primer:TATGCTGCCCAAGAATATGGOvergo seq rv:
Tm:62.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5734Mimulus unigene:MlU5923Phytome id:
 Arabidopsis homolog:At5g67320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATCCTATGATGGCTTTGCOvergo seq fw:
Reverse primer:AGTGTCCTGAACTGGCATCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5735Mimulus unigene:MlU5972Phytome id:
 Arabidopsis homolog:At4g34460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTACACTCAGAGGTCACTTGGOvergo seq fw:
Reverse primer:GTGTGACCAGGCAATTCACGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5736Mimulus unigene:MlU6221Phytome id:
 Arabidopsis homolog:At5g51970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTCTAAGGGCGATCTGAGGOvergo seq fw:
Reverse primer:CACAGAACCGCATCTTTCGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5737Mimulus unigene:MlU6343Phytome id:
 Arabidopsis homolog:At1g03910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGTTGACAATTTTGAATGCOvergo seq fw:
Reverse primer:GAAAAGAAGGCTCGTGAAGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5738Mimulus unigene:MlU6438Phytome id:
 Arabidopsis homolog:At3g20020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCAGTCGATACAAAGTTGCOvergo seq fw:
Reverse primer:TGGCAAATGGGATCATGCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5739Mimulus unigene:MlU6482Phytome id:
 Arabidopsis homolog:At1g23190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTCCACCCTGGTTGTTGGOvergo seq fw:
Reverse primer:CCGTATGACATGAGACACAGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5740Mimulus unigene:MlU6568Phytome id:
 Arabidopsis homolog:At3g52200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGATGCCATCATTATCTCCOvergo seq fw:
Reverse primer:GCCCACTTTGACATCTTTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5741Mimulus unigene:MlU6630Phytome id:
 Arabidopsis homolog:At2g27600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGAAAACTGAAGGCTTTTCCOvergo seq fw:
Reverse primer:ACTGTTGGCCTCTGTCTTGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5742Mimulus unigene:MlU6664Phytome id:
 Arabidopsis homolog:At4g30800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTTCAAAAGCAGCCAACGOvergo seq fw:
Reverse primer:GAACAGTGCCAGTAAGGATGCOvergo seq rv:
Tm:61.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5743Mimulus unigene:MlU6904Phytome id:
 Arabidopsis homolog:At5g37290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTGGACTGCCTATCAGAGCOvergo seq fw:
Reverse primer:CTACCCAAGAAAGCCTGAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5744Mimulus unigene:MlU7064Phytome id:
 Arabidopsis homolog:At1g15215
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTTTCGAAGCCAGATCAGCOvergo seq fw:CGCTCACTCCCTCTAGAACCTTCG
Reverse primer:CACATTCCGAAGGTTCTAGAGGOvergo seq rv: TGACTTTGTCACATTCCGAAGGTT
Tm:60.1Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5745Mimulus unigene:MlU7268Phytome id:
 Arabidopsis homolog:At5g19660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCTGGAACCAGCGTAGCOvergo seq fw:
Reverse primer:CCGAACTGAGGAGCATAAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5746Mimulus unigene:MlU7449Phytome id:
 Arabidopsis homolog:At1g76400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTTGAAGATGCGTCTTATGGOvergo seq fw:
Reverse primer:CAGGTCTGCCAATTGTATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5747Mimulus unigene:MlU7497Phytome id:
 Arabidopsis homolog:At3g57090
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGGGCTCTTGTTCATTCCOvergo seq fw:
Reverse primer:GACATAGCTTGTCTCCAATCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5748Mimulus unigene:MlU7556Phytome id:
 Arabidopsis homolog:At2g26580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGGCACCTAGCTACAATCCOvergo seq fw:
Reverse primer:CGGATTATTTGCCTTGATCCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5750Mimulus unigene:MlU7615Phytome id:
 Arabidopsis homolog:At4g24830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGTGGTAGCGTTCCTTGCOvergo seq fw:
Reverse primer:TCATTTCCTTTGCCAGTTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5751Mimulus unigene:MlU7756Phytome id:
 Arabidopsis homolog:At5g66240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAGCAGTGATGATGAATCCOvergo seq fw:
Reverse primer:AAGGAACGTGTCGTCTATTGGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5752Mimulus unigene:MlU7765Phytome id:
 Arabidopsis homolog:At2g17790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGAGAAAGAAATGGTGAGGOvergo seq fw:
Reverse primer:TCTCGTCTCTCTTGCTCACGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5753Mimulus unigene:MlU7768Phytome id:
 Arabidopsis homolog:At5g58330
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTACGCCTGAGGGAGATTGGOvergo seq fw:CTGCTTGCTGAGAAGAAATGTGTA
Reverse primer:CCAGGAAGATCACACACAGCOvergo seq rv: CTCCTGTGAGATGGGCTACACATT
Tm:62.1Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5754Mimulus unigene:MlU7805Phytome id:
 Arabidopsis homolog:At5g46210
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAGATTCAAATGAAAGAGACGOvergo seq fw:
Reverse primer:GTCAGCCGGTTTGACTGGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5755Mimulus unigene:MlU7841Phytome id:
 Arabidopsis homolog:At1g67120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTTTGGTGCTGATTTGCOvergo seq fw:
Reverse primer:AGATACGCGTACTGGCTTGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5756Mimulus unigene:MlU7898Phytome id:
 Arabidopsis homolog:At5g55310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGTCGAGGAGACCATCCOvergo seq fw:
Reverse primer:GGGCCACTTCATACTTTTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5757Mimulus unigene:MlU7937Phytome id:
 Arabidopsis homolog:At3g20330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCATCCGAACAAACATACCOvergo seq fw:
Reverse primer:CCCACCAACTCTTGAAATGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5758Mimulus unigene:MlU7942Phytome id:
 Arabidopsis homolog:At5g47780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACTGACCTTTGGTCTCTCGOvergo seq fw:
Reverse primer:GAGCCATGGTTTCAAATTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5759Mimulus unigene:MlU7947Phytome id:
 Arabidopsis homolog:At1g20380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTACCATGGACACAAAGTTGCOvergo seq fw:
Reverse primer:TCTGACGATGAGGACACTGCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5760Mimulus unigene:MlU7948Phytome id:
 Arabidopsis homolog:At1g76140
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCAACAGGAGGGTTGAGGOvergo seq fw:
Reverse primer:AATGGCGGACTACTTGTTGCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5761Mimulus unigene:MlU7966Phytome id:
 Arabidopsis homolog:At5g41370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGACATGCTCATGATTTCCOvergo seq fw:
Reverse primer:GGCATTCTTGGATCACTGGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5762Mimulus unigene:MlU7967Phytome id:
 Arabidopsis homolog:At5g41360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTACCAAAAACCGCTGTCGOvergo seq fw:
Reverse primer:TCATTCGATCTCCCAGAAGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5763Mimulus unigene:MlU8031Phytome id:
 Arabidopsis homolog:At5g50430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGTTTCAAGTGCAATACTCGOvergo seq fw:
Reverse primer:CTAGGCTGCCCAGAGTTGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5764Mimulus unigene:MlU8039Phytome id:
 Arabidopsis homolog:At5g41970
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAAGCTTCATTTGTTTGAGCOvergo seq fw:ACTTATGAGGGTGCACTCGCAATG
Reverse primer:CCCACTCATATGAACAAAAACGOvergo seq rv: TAAGGGCAGCTTTTGCCATTGCGA
Tm:59.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5765Mimulus unigene:MlU8086Phytome id:
 Arabidopsis homolog:At1g18070
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGAAAACTGTGGAAGTTGGOvergo seq fw:
Reverse primer:TTTTTCTGACCATTCTACTGTTGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5766Mimulus unigene:MlU8120Phytome id:
 Arabidopsis homolog:At4g33090
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGGACAGTTTGCTCTTGACGOvergo seq fw:
Reverse primer:CCAGGAAGCAAAACCTTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5767Mimulus unigene:MlU8189Phytome id:
 Arabidopsis homolog:At3g20050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTTGTCACGTACCGTTCCOvergo seq fw:
Reverse primer:GAAGCGTGTGCTTGAGTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5768Mimulus unigene:MlU8277Phytome id:
 Arabidopsis homolog:At2g41790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTCGGCCCATTTTATGACCOvergo seq fw:
Reverse primer:AAGAATACTTCCAGCACCTTCGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5769Mimulus unigene:MlU8280Phytome id:
 Arabidopsis homolog:At4g38890
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAAGGAACAGAGGCATTGGOvergo seq fw:AGCTGTCGACATGTATGATTGCCC
Reverse primer:GCAAATGTGAATCCAGAAGGOvergo seq rv: TTAACCAACGCTCCACGGGCAATC
Tm:61.2Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5770Mimulus unigene:MlU8374Phytome id:
 Arabidopsis homolog:At3g04770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCAAGAACTGCCACTACCOvergo seq fw:
Reverse primer:GGGTCGGTGAGGATGAGCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5771Mimulus unigene:MlU8387Phytome id:
 Arabidopsis homolog:At4g21710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTGGGGATACAGCAGTCCOvergo seq fw:
Reverse primer:TTGTAGCTAGTGGGGTTGTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5772Mimulus unigene:MlU8401Phytome id:
 Arabidopsis homolog:At1g04790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCCAACCGTGATTTTAACGOvergo seq fw:
Reverse primer:AGGATGTTTTCCTCCTCAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5773Mimulus unigene:MlU8546Phytome id:
 Arabidopsis homolog:At2g47610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACTTGCAACCCAAAATACCOvergo seq fw:
Reverse primer:TCTGGAGCCAATACTGTGACCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5774Mimulus unigene:MlU8560Phytome id:
 Arabidopsis homolog:At3g59990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGGTGGTGAAGCAACTAGGOvergo seq fw:
Reverse primer:AAACTGAGCCGTGTAACAACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5775Mimulus unigene:MlU8561Phytome id:
 Arabidopsis homolog:At3g59990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACTGAGCCGTGTAACAACCOvergo seq fw:
Reverse primer:AGGGTGGTGAAGCAACTAGGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5776Mimulus unigene:MlU8634Phytome id:
 Arabidopsis homolog:At2g27920
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGAAAGTACGCCGTTACCOvergo seq fw:AACAAACCATGGCCTATCATACTT
Reverse primer:GTCGCCTCAACAAACTTTCCOvergo seq rv: GTCCACCCTGCAGCCAAAGTATGA
Tm:59.5Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5777Mimulus unigene:MlU8635Phytome id:
 Arabidopsis homolog:At2g27920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACACAGGGCTGATCAACAGGOvergo seq fw:
Reverse primer:TGCACTTTTACTGGATTCTTGGOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5778Mimulus unigene:MlU8750Phytome id:
 Arabidopsis homolog:At1g08190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAGTTTGATTCAGAGAAAGCOvergo seq fw:
Reverse primer:ATGCCCCTTTTGTGTCACCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5779Mimulus unigene:MlU8815Phytome id:
 Arabidopsis homolog:At1g65810
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGGGAATGGATCTGTTGGOvergo seq fw:
Reverse primer:CCACTTCCTCGTGAATTTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5780Mimulus unigene:MlU8924Phytome id:
 Arabidopsis homolog:At2g31970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCACAAAGTTCTCATCATGGOvergo seq fw:
Reverse primer:TGACATGAGGGCAAGATGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5781Mimulus unigene:MlU8953Phytome id:
 Arabidopsis homolog:At1g12230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGCGGCCATATCTTCCOvergo seq fw:
Reverse primer:GGGCATAACTCAAAATTGATGGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5782Mimulus unigene:MlU9116Phytome id:
 Arabidopsis homolog:At5g47010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTGTGTTGGGCATTCGOvergo seq fw:
Reverse primer:GAACGCAAAAACCGTGTAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5783Mimulus unigene:MlU9162Phytome id:
 Arabidopsis homolog:At4g30600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATACTGCTGGGAGAATGCOvergo seq fw:
Reverse primer:GAGTAGAGCCTGGACAACAGCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5784Mimulus unigene:MlU9184Phytome id:
 Arabidopsis homolog:At3g48380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGAGCTTGCTGAATTTGGOvergo seq fw:
Reverse primer:AAGGTCGCTACAGCTATCACCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5785Mimulus unigene:MlU9240Phytome id:
 Arabidopsis homolog:At3g10550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTCTGGGCACAGTTGACCOvergo seq fw:
Reverse primer:GGAGTGTGTTCTTTCTGACAACCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5786Mimulus unigene:MlU9261Phytome id:
 Arabidopsis homolog:At5g03650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCTGTCTCATGCTTCAGGOvergo seq fw:
Reverse primer:CTCATTACAATTGGGCTTGGOvergo seq rv:
Tm:57.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5787Mimulus unigene:MlU9422Phytome id:
 Arabidopsis homolog:At1g44900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGAAGTACGCCCAGGTTCCOvergo seq fw:
Reverse primer:TTTGAAAGGGCCACAATAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5788Mimulus unigene:MlU9423Phytome id:
 Arabidopsis homolog:At1g44900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAATGACATTTGGTCTTGAGCOvergo seq fw:
Reverse primer:CCAAGATGTATGCAGAGTTGCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5789Mimulus unigene:MlU9449Phytome id:
 Arabidopsis homolog:At5g26360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCATGTTGAAGATGTTGATGGOvergo seq fw:
Reverse primer:GTACGGGCTACTTCAATAATGGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5790Mimulus unigene:MlU9479Phytome id:
 Arabidopsis homolog:At4g16660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCCAACACAGAACATTATGCOvergo seq fw:
Reverse primer:CAGCTCTTTGCGTTTTACAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5791Mimulus unigene:MlU9547Phytome id:
 Arabidopsis homolog:At3g54660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCTAAAGGCAACTCTTTCAGGOvergo seq fw:
Reverse primer:GGCATCAGAATCTGCTTTTCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5792Mimulus unigene:MlU9580Phytome id:
 Arabidopsis homolog:At4g04940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTATAACCTGTGTCGGGAAGGOvergo seq fw:
Reverse primer:TATGAACAGCGCTTTTGTGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5793Mimulus unigene:MlU9591Phytome id:
 Arabidopsis homolog:At2g44100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCATTCTTGATCATTGTATTCCOvergo seq fw:
Reverse primer:AAAGAGCCGACTGTCTGTACCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5794Mimulus unigene:MlU9638Phytome id:
 Arabidopsis homolog:At3g56190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCAAATGCATTCAAGATGGOvergo seq fw:
Reverse primer:AAAACATTGTCCAGCAGAAGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5795Mimulus unigene:MlU9649Phytome id:
 Arabidopsis homolog:At2g16440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCAAAAGACTGCACATGGOvergo seq fw:
Reverse primer:TTCCCGGATGTGTACTGTCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5796Mimulus unigene:MlU9731Phytome id:
 Arabidopsis homolog:At5g41150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGATAGTTTTTCAAATTGACTCCOvergo seq fw:
Reverse primer:CATGAGCCGACATTACAAGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5797Mimulus unigene:MlU9758Phytome id:
 Arabidopsis homolog:At1g54100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTAATTCTTTGCTGTAGTTGATGGOvergo seq fw:
Reverse primer:ATGCTGAAGTGGTGCAGAGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5798Mimulus unigene:MlU9766Phytome id:
 Arabidopsis homolog:At5g08380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGAACGATATGCCTTTTGGOvergo seq fw:
Reverse primer:TCCTGGTTTAGCAACTTCAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5799Mimulus unigene:MlU9803Phytome id:
 Arabidopsis homolog:At3g17205
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCTGGGACGGATGTTAGGOvergo seq fw:
Reverse primer:AGACTTTTGGCAAGCTCTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5800Mimulus unigene:MlU9808Phytome id:
 Arabidopsis homolog:At1g50200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCTTCTCTGCTTGCATCCOvergo seq fw:
Reverse primer:AGTAAGACACCACACTCAACACCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5801Mimulus unigene:MlU9827Phytome id:
 Arabidopsis homolog:At5g26710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAATCAAGAAGGACGAAAATGGOvergo seq fw:
Reverse primer:TTCGAAGGTCGAACAAATGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5802Mimulus unigene:MlU9904Phytome id:
 Arabidopsis homolog:At2g36530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTAGCGGTGCATCTACTGGOvergo seq fw:
Reverse primer:AACACCAAGAATGGCATTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5803Mimulus unigene:MlU10005Phytome id:
 Arabidopsis homolog:At2g32520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGATGCCTACGTGATTGGOvergo seq fw:
Reverse primer:CAACAGCATCAATGGTAGGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):