Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1400 - 1499) out of 1979 markers

MlSTS5582Mimulus unigene:MlU4130Phytome id:
 Arabidopsis homolog:At3g58610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGTCGTTGAGCAGTTGTCGOvergo seq fw:
Reverse primer:CACTGCAGGTGTCTTTGTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5583Mimulus unigene:MlU4138Phytome id:
 Arabidopsis homolog:At5g47780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGCAAATATTGGTGATCGOvergo seq fw:
Reverse primer:ACCTTTCATCGGTTTGATCGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5584Mimulus unigene:MlU4165Phytome id:
 Arabidopsis homolog:At1g15490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACTGGCAACATTTCAACTGCOvergo seq fw:
Reverse primer:GATGATGGAGGACTGCTTGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5585Mimulus unigene:MlU4168Phytome id:
 Arabidopsis homolog:At3g01270
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTGCCATTTCTTCCATTCGOvergo seq fw:
Reverse primer:CTGTCCAAAGGCTCTGATGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5586Mimulus unigene:MlU4170Phytome id:
 Arabidopsis homolog:At3g23940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTCGCTCGTTCAACTCCOvergo seq fw:
Reverse primer:GAAGGTTTTCTGGAGGTTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5587Mimulus unigene:MlU4177Phytome id:
 Arabidopsis homolog:At3g05590
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCTGGTGAGGAGGACTGGOvergo seq fw:GACGAAGCGCACGAAGCCCAGATC
Reverse primer:GTGGAGCCCTAAGAGCAAGCOvergo seq rv: GATGTAGATATCATCTGATCTGGG
Tm:60.2Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5588Mimulus unigene:MlU4187Phytome id:
 Arabidopsis homolog:At3g03570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTCCGGGCTAAAGAGATGGOvergo seq fw:
Reverse primer:GCTGTGTCGGCTTTCAGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5589Mimulus unigene:MlU4188Phytome id:
 Arabidopsis homolog:At3g03570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTACCCCAAACAAATCTGCOvergo seq fw:
Reverse primer:CTGTCATTAAATAAACTGGGATCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5590Mimulus unigene:MlU4191Phytome id:
 Arabidopsis homolog:At4g13930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGCGTTGTTCACAAGTCCOvergo seq fw:
Reverse primer:ATCTCGTCACTGGTGGAACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5591Mimulus unigene:MlU4206Phytome id:
 Arabidopsis homolog:At1g14830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTTTTGACCATCAACTACCGOvergo seq fw:
Reverse primer:TCACGAAACTTCTCCAGTGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5592Mimulus unigene:MlU4213Phytome id:
 Arabidopsis homolog:At3g52990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCCATTCTGGAGCCATCCOvergo seq fw:
Reverse primer:CAGGGCCCACAGTATCTAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5593Mimulus unigene:MlU4227Phytome id:
 Arabidopsis homolog:At3g49160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACAGCTTTCGCAACATGCOvergo seq fw:
Reverse primer:CACATGCTGACATGGTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5594Mimulus unigene:MlU4232Phytome id:
 Arabidopsis homolog:At2g30440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCAATACGAACACGTAGCCOvergo seq fw:
Reverse primer:CGGACATTGTGATTTTCAAGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5595Mimulus unigene:MlU4234Phytome id:
 Arabidopsis homolog:At3g20580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACGATGGGTTCAAATGTCCOvergo seq fw:
Reverse primer:ACTCGTTCCTCATCCACTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5596Mimulus unigene:MlU4239Phytome id:
 Arabidopsis homolog:At3g12680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTGGAGAGAAGGACTGTGCOvergo seq fw:
Reverse primer:GAAGGGACTCACTTGCTACAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5597Mimulus unigene:MlU4240Phytome id:
 Arabidopsis homolog:At3g12680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGAAACTTGCAGGTAATGCOvergo seq fw:
Reverse primer:ACTTGCCGCTACAATCATCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5598Mimulus unigene:MlU4243Phytome id:
 Arabidopsis homolog:At3g44330
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGCAAGTCGAATGTCACGOvergo seq fw:GAAGTCGGACGGCGAAACAGACTG
Reverse primer:GGGAAAAACGTTGATATATTTGCOvergo seq rv: GTCTTGATGATCTGATCAGTCTGT
Tm:58.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5599Mimulus unigene:MlU4269Phytome id:
 Arabidopsis homolog:At5g26250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTATCTTGCGGCTCTCGOvergo seq fw:
Reverse primer:GAGGAGACGACGTAGTTGACGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5600Mimulus unigene:MlU4270Phytome id:
 Arabidopsis homolog:At3g03305
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCATGCACGAAGTTGTCCOvergo seq fw:
Reverse primer:GGTTTTTCCGGAGTTTGAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5601Mimulus unigene:MlU4277Phytome id:
 Arabidopsis homolog:At1g60780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAACAATGTGTATCTCATGACTGCOvergo seq fw:
Reverse primer:GGAGGCCTCTGTGTAACTTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5602Mimulus unigene:MlU4294Phytome id:
 Arabidopsis homolog:At2g40550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGTTGAATCTTCTCATGAAGCOvergo seq fw:
Reverse primer:CTCAAGGGTCCTTCCATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5603Mimulus unigene:MlU4295Phytome id:
 Arabidopsis homolog:At2g40550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCAAGTACCACCTCCAAGCOvergo seq fw:
Reverse primer:TTCACTTGTCCCGAAGAAGGOvergo seq rv:
Tm:62.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5604Mimulus unigene:MlU4297Phytome id:
 Arabidopsis homolog:At1g71920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGTGTGCTCCGGTTTCCOvergo seq fw:
Reverse primer:CGAAAATCTAATCGTCCTTCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5605Mimulus unigene:MlU4299Phytome id:
 Arabidopsis homolog:At5g17520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCAATGGGCTTATGATTCCOvergo seq fw:
Reverse primer:ATGGGCTTGTGCATCTTTCCOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5606Mimulus unigene:MlU4306Phytome id:
 Arabidopsis homolog:At5g46180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGTTTGGGATCCAGAAGGOvergo seq fw:
Reverse primer:TAATGTGCGACCATGAAAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5607Mimulus unigene:MlU4307Phytome id:
 Arabidopsis homolog:At5g46180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCCAGAACGTCCATTAGGOvergo seq fw:
Reverse primer:TTTGGAGGGAACCCTTTAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5608Mimulus unigene:MlU4315Phytome id:
 Arabidopsis homolog:At3g06540
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGAACGAAGGAAGTGAGGOvergo seq fw:
Reverse primer:TGAGGAAGTTCCCCTTGACCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5609Mimulus unigene:MlU4329Phytome id:
 Arabidopsis homolog:At1g78880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCCTCGCATCTCAAAACGOvergo seq fw:
Reverse primer:GAGAGCATTGGTGAAGACTGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5610Mimulus unigene:MlU4336Phytome id:
 Arabidopsis homolog:At1g16710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAACTACCTGCGACCTCTGCOvergo seq fw:
Reverse primer:TCTCCACATTGCCAGTATCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5611Mimulus unigene:MlU4342Phytome id:
 Arabidopsis homolog:At4g22350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCGGGAAGTATTACCAAGGOvergo seq fw:
Reverse primer:TGGACCACTGCCTATTCTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5612Mimulus unigene:MlU4343Phytome id:
 Arabidopsis homolog:At4g22350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGTCTCCGACACATGAAGGOvergo seq fw:
Reverse primer:AAGTTGTCCGTCCTCGTATAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5613Mimulus unigene:MlU4345Phytome id:
 Arabidopsis homolog:At1g11910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGGTGCCACATCTAAGGOvergo seq fw:
Reverse primer:AGCAATCGACACTCATTTGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5614Mimulus unigene:MlU4346Phytome id:
 Arabidopsis homolog:At3g60770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAAAGAAAGGGATGACTCCOvergo seq fw:
Reverse primer:GCTGGCAGTTGTTGACTCGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5615Mimulus unigene:MlU4355Phytome id:
 Arabidopsis homolog:At2g33150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCCATTGACATTGATTTTTGCOvergo seq fw:
Reverse primer:AGTCTTGCCATGCAGAAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5616Mimulus unigene:MlU4358Phytome id:
 Arabidopsis homolog:At4g24830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGGTTGTTTGCTTCACTGCOvergo seq fw:
Reverse primer:TTTCCTTTTCCAGTGCATCCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5618Mimulus unigene:MlU4361Phytome id:
 Arabidopsis homolog:At1g42470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCAAAGCACAAGAACAATAGCOvergo seq fw:
Reverse primer:GGCGAAATGTGTTGAAGTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5619Mimulus unigene:MlU4363Phytome id:
 Arabidopsis homolog:At3g52880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGTCCAGCACTTAGCAAGGOvergo seq fw:
Reverse primer:CAGAACCAGTTGCGATGACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5620Mimulus unigene:MlU4385Phytome id:
 Arabidopsis homolog:At1g11170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTGGAGCAAGGCAAAAGGOvergo seq fw:
Reverse primer:CAACACCGAGGTCTTCATCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5621Mimulus unigene:MlU4391Phytome id:
 Arabidopsis homolog:At5g62190
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGCCGATAAAAAGACTGTCGOvergo seq fw:CCCTGGTGGCTACAAATGTAGCAG
Reverse primer:CACCAGGGTTGTGAATTTGCOvergo seq rv: ATATCCAATCCTCGTGCTGCTACA
Tm:59.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5622Mimulus unigene:MlU4393Phytome id:
 Arabidopsis homolog:At4g38640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGCATAGCACACGTACACCOvergo seq fw:
Reverse primer:GCGCTGTGGTTGATAGTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5623Mimulus unigene:MlU4395Phytome id:
 Arabidopsis homolog:At2g20900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTAAGATGCTTGGCATGGOvergo seq fw:
Reverse primer:CCCCAACAGACTCATCTTCCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5624Mimulus unigene:MlU4401Phytome id:
 Arabidopsis homolog:At3g01150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAACCTTCCTTGGGAGTGCOvergo seq fw:
Reverse primer:ACATTTCCCGGAACATCTCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5625Mimulus unigene:MlU4408Phytome id:
 Arabidopsis homolog:At4g02800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGCAGTCTCTCTCTCAGCOvergo seq fw:
Reverse primer:CATGGTAGCCGCTTTAGTCGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5626Mimulus unigene:MlU4421Phytome id:
 Arabidopsis homolog:At5g22760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTAGCAGGCAGCTTTTCTGGOvergo seq fw:
Reverse primer:AACTGCCTTCTCTGAAGTTTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5627Mimulus unigene:MlU4423Phytome id:
 Arabidopsis homolog:At4g01020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCAGAGAATACGATGTCAGCOvergo seq fw:
Reverse primer:TTCCGTCTCGTGAAAAGAGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5628Mimulus unigene:MlU4424Phytome id:
 Arabidopsis homolog:At1g21690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTGAAGATGCCCAGAATGCOvergo seq fw:
Reverse primer:GTTGAAAGAGCCTCTGAATCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5629Mimulus unigene:MlU4427Phytome id:
 Arabidopsis homolog:At2g28470
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGTGTTTTTGGCTTTGGOvergo seq fw:AGACCTACGTTTTCTGGGACATGC
Reverse primer:TCCATTCAGCACAAACATAAGGOvergo seq rv: CCTCGAACTGGTTCATGCATGTCC
Tm:59.0Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5630Mimulus unigene:MlU4433Phytome id:
 Arabidopsis homolog:At5g52590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTACAAAATTCAGAGAGAGAAAAGGOvergo seq fw:
Reverse primer:TTCCATAAGGGAAACGAAGCOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5631Mimulus unigene:MlU4441Phytome id:
 Arabidopsis homolog:At4g27500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCTTGGCAAATTGAGAGGOvergo seq fw:
Reverse primer:CATCGAGCTGCTTAAGTTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5632Mimulus unigene:MlU4445Phytome id:
 Arabidopsis homolog:At1g11260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATATCCCGGCAACCTAACGOvergo seq fw:
Reverse primer:GTCTCGCTGTCGAATTTGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5633Mimulus unigene:MlU4460Phytome id:
 Arabidopsis homolog:At2g05990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGAAGCAGGAAGGAAACGOvergo seq fw:
Reverse primer:CGCGTTCAGACCATTATCGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5634Mimulus unigene:MlU4466Phytome id:
 Arabidopsis homolog:At4g34640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGCGGAGAAGCAGATCCOvergo seq fw:
Reverse primer:TGTCAAGTGCTCGAAGAACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5635Mimulus unigene:MlU4492Phytome id:
 Arabidopsis homolog:At2g22125
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGAAGGTCCGCTTTTGCOvergo seq fw:
Reverse primer:GTTTCTGCTGCAGTGTTTGCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5636Mimulus unigene:MlU4495Phytome id:
 Arabidopsis homolog:At1g15200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAACTCCGCAAAGAGATCGOvergo seq fw:
Reverse primer:TTCTTTTCCACATCGACTGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5637Mimulus unigene:MlU4517Phytome id:
 Arabidopsis homolog:At1g48650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGAAAGGAAGCAGTCTGGOvergo seq fw:
Reverse primer:CCAAGGAAATCGAATTTTGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5638Mimulus unigene:MlU4520Phytome id:
 Arabidopsis homolog:At3g11710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGGGTTGGAAGAGATTGCOvergo seq fw:
Reverse primer:TTGAGTTGGTCAGCAAAACGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5639Mimulus unigene:MlU4521Phytome id:
 Arabidopsis homolog:At2g23940
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCAAGGAGCGAAGAAACGOvergo seq fw:AAGAGGGCATCAAGAGGCAAATTT
Reverse primer:GAAATGATGGAGCTGAGTTGGOvergo seq rv: GGGTCCTCGTCTTGACAAATTTGC
Tm:59.5Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5640Mimulus unigene:MlU4527Phytome id:
 Arabidopsis homolog:At2g31960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTGAGGACCTGTCTTTCCOvergo seq fw:
Reverse primer:CAGCGCAAATTTTCAACTCGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5641Mimulus unigene:MlU4529Phytome id:
 Arabidopsis homolog:At5g57800
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGGGAAATCCTTGGTAGCOvergo seq fw:CACTCGCAATCGCACCATCGTCAA
Reverse primer:TCCCATTTTTGTTCCACACCOvergo seq rv: AAAATCGACGCCTTTCTTGACGAT
Tm:59.4Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5642Mimulus unigene:MlU4557Phytome id:
 Arabidopsis homolog:At4g35360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAGGATTTGAAGAAAGATCCOvergo seq fw:
Reverse primer:GAGGGACAAGATTCTGACAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5663Mimulus unigene:MlU4680Phytome id:
 Arabidopsis homolog:At1g58025
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAATGATGGTGCTTTGAGCOvergo seq fw:
Reverse primer:ACTGGCAACCTTCCTTATGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5664Mimulus unigene:MlU4687Phytome id:
 Arabidopsis homolog:At5g58370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTTGTTAAAACTATTTGGTACTTGGOvergo seq fw:
Reverse primer:GTGGATTTGCCTGGTTATGGOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5665Mimulus unigene:MlU4707Phytome id:
 Arabidopsis homolog:At4g09980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACACTCCGTCTTTCATCTTCCOvergo seq fw:
Reverse primer:ACGCACAGTCCCTTTTATGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5666Mimulus unigene:MlU4718Phytome id:
 Arabidopsis homolog:At3g44880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCCAGCGCTTAGAATTGCOvergo seq fw:
Reverse primer:CGACGGGGATATGATAGTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5667Mimulus unigene:MlU4719Phytome id:
 Arabidopsis homolog:At2g13680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCTACAGATTGGGGCATCGOvergo seq fw:
Reverse primer:CCGGTGGCTCTGTATTTAGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5668Mimulus unigene:MlU4734Phytome id:
 Arabidopsis homolog:At3g62830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCGGATTGAAACGCAAGGOvergo seq fw:
Reverse primer:TGCCCCAGTAAGTCTCAACCOvergo seq rv:
Tm:61.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5669Mimulus unigene:MlU4735Phytome id:
 Arabidopsis homolog:At2g47650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAGACCATCATAGGGAGACCOvergo seq fw:
Reverse primer:CGTTGGACCTTTCAATCTCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5670Mimulus unigene:MlU4746Phytome id:
 Arabidopsis homolog:At1g76510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCAAGGATTTTCAACTTGCOvergo seq fw:
Reverse primer:TGGGTGAAGATCAACATTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5671Mimulus unigene:MlU4753Phytome id:
 Arabidopsis homolog:At1g77720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATACACTGAGGGGGAAGAGCOvergo seq fw:
Reverse primer:CCTCATGAATGGTGTTTACGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5672Mimulus unigene:MlU4762Phytome id:
 Arabidopsis homolog:At2g15900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTGTGGGATTTTCTGAGTGCOvergo seq fw:
Reverse primer:CAGGAAAGGTTTCTGCTTGCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5673Mimulus unigene:MlU4765Phytome id:
 Arabidopsis homolog:At4g38600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATTTGCATTGCTGCTAGGGOvergo seq fw:
Reverse primer:GGCTGAGTCACTTGCAGACCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5674Mimulus unigene:MlU4775Phytome id:
 Arabidopsis homolog:At2g34250
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATTGCACCCATAAGATCGOvergo seq fw:
Reverse primer:ATTCCTGTTGGTGGTCTTGCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5675Mimulus unigene:MlU4779Phytome id:
 Arabidopsis homolog:At3g05940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATGAGGGAAAGATCATAAGCOvergo seq fw:
Reverse primer:TGACTTTTACCATGATACAGTTCACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5676Mimulus unigene:MlU4792Phytome id:
 Arabidopsis homolog:At5g38200
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTCTGATGGTCTGATCGOvergo seq fw:CCGAAGAATCTGAACTCGAGGACA
Reverse primer:TCCTCGAGTTCAGATTCTTCGOvergo seq rv: TCCAGAAACTCTTCGTTGTCCTCG
Tm:59.9Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5677Mimulus unigene:MlU4805Phytome id:
 Arabidopsis homolog:At2g29990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCGTAAATCGACCAAAGCOvergo seq fw:
Reverse primer:ATTTCCCCAAGGCTCTCGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5678Mimulus unigene:MlU4807Phytome id:
 Arabidopsis homolog:At2g20860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCAGCCTTGTACGATGACCOvergo seq fw:
Reverse primer:TCAATAATGTTGGGCTGTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5679Mimulus unigene:MlU4817Phytome id:
 Arabidopsis homolog:At5g39590
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCCCCTAATCCCCATACCOvergo seq fw:
Reverse primer:TTCGTTTTACGGAACTTCTGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5680Mimulus unigene:MlU4825Phytome id:
 Arabidopsis homolog:At3g11240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCTCGTTGACAGAGGTTGGOvergo seq fw:
Reverse primer:AAACTCCCCACTTTTCATGCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5681Mimulus unigene:MlU4842Phytome id:
 Arabidopsis homolog:At2g27170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCTCAACAAAATCCAAAGCOvergo seq fw:
Reverse primer:TGATCAAGATGACGATGAGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5682Mimulus unigene:MlU4843Phytome id:
 Arabidopsis homolog:At1g80300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCTTCTTCTTGCCTCAGTGCOvergo seq fw:
Reverse primer:GGGATGACCCCACTTTTAGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5683Mimulus unigene:MlU4870Phytome id:
 Arabidopsis homolog:At2g26710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATTATTCAACCCCTTTTCCOvergo seq fw:
Reverse primer:CAATGAGATTCAACAACGATTCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5684Mimulus unigene:MlU4874Phytome id:
 Arabidopsis homolog:At2g30290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAAGCCGAGAACGATGATCCOvergo seq fw:
Reverse primer:CAGTATGGACGGACTTATTCTGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5685Mimulus unigene:MlU4876Phytome id:
 Arabidopsis homolog:At1g31970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGGAAGAAACCGCAAACGOvergo seq fw:
Reverse primer:AGAGCAGGGATACCAAATGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5686Mimulus unigene:MlU4877Phytome id:
 Arabidopsis homolog:At1g31970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAACTTGATTTTTGTAGCTTTGGOvergo seq fw:
Reverse primer:GAGGATTGGATATTCCTGACGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5687Mimulus unigene:MlU4882Phytome id:
 Arabidopsis homolog:At5g48600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGCTAACTCAAACATGTTATTCCOvergo seq fw:
Reverse primer:TTGGATCCATTTTCAGAAGGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5688Mimulus unigene:MlU4890Phytome id:
 Arabidopsis homolog:At4g15110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACAATGCTCCTGGGCTACGOvergo seq fw:
Reverse primer:GGAATCTCTCCGTTTGTTCCOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5689Mimulus unigene:MlU4904Phytome id:
 Arabidopsis homolog:At2g45030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTGAGAAACTTGGGAATGCOvergo seq fw:
Reverse primer:ATTGGAGCCTTTGATGATGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5690Mimulus unigene:MlU4905Phytome id:
 Arabidopsis homolog:At2g26990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGATATCGGCGAATACGGOvergo seq fw:
Reverse primer:AAGAAATCAGTAGCTGCATCTGGOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5691Mimulus unigene:MlU4906Phytome id:
 Arabidopsis homolog:At2g26990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCCATCAATTCGATTATCCOvergo seq fw:
Reverse primer:TCTGGCAAATATGCTGATGGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5692Mimulus unigene:MlU4912Phytome id:
 Arabidopsis homolog:At1g23190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGGATCCTGCTCATATTGCOvergo seq fw:
Reverse primer:TGATGCTGGTAGTGCAAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5693Mimulus unigene:MlU4914Phytome id:
 Arabidopsis homolog:At5g28470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGCCATAGTTTCTGATGCOvergo seq fw:
Reverse primer:GGAAGATGGTGATGGAGAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5694Mimulus unigene:MlU4915Phytome id:
 Arabidopsis homolog:At5g28470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTTGCTAGCGAAAAACACGOvergo seq fw:
Reverse primer:GAAGATGCACCACAAGATCGOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5695Mimulus unigene:MlU4918Phytome id:
 Arabidopsis homolog:At1g53240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCAACTCGGGTTTGAGAGCOvergo seq fw:
Reverse primer:GGTTCAGCTACACTTTCGATGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5696Mimulus unigene:MlU4934Phytome id:
 Arabidopsis homolog:At1g70330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTTATACCCCGGAGAGTCGOvergo seq fw:
Reverse primer:CGCGCTTTGTCTCAGTCCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5697Mimulus unigene:MlU4936Phytome id:
 Arabidopsis homolog:At4g11810
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGACACTTTGCCTGGTTGGOvergo seq fw:
Reverse primer:AAGGAGTTGGCTGGTCTACGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5698Mimulus unigene:MlU4940Phytome id:
 Arabidopsis homolog:At1g02205
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATAAAGGAGGCTCATAATCTGCOvergo seq fw:
Reverse primer:AGATGAATTTCGGGATGTGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5699Mimulus unigene:MlU4943Phytome id:
 Arabidopsis homolog:At4g01660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTGCCATTAGCTTCTTCAGCOvergo seq fw:
Reverse primer:GGAGCAGCTAGGGACTACCCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5700Mimulus unigene:MlU4947Phytome id:
 Arabidopsis homolog:At1g74030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGTCCAACTGACAAATCTGCOvergo seq fw:
Reverse primer:TCAAGAAACAACCAAATGATGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5701Mimulus unigene:MlU4957Phytome id:
 Arabidopsis homolog:At3g59990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTGCAAGTTGGACGAAGCOvergo seq fw:
Reverse primer:GGAGGAGGGTGAATTTTATGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5702Mimulus unigene:MlU4959Phytome id:
 Arabidopsis homolog:At1g72680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCTGTGTCTGCTTTGTTCCOvergo seq fw:
Reverse primer:AAATTTGGGAAGGCTTTTGGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):