Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1300 - 1399) out of 1979 markers

MlSTS5482Mimulus unigene:MlU3563Phytome id:
 Arabidopsis homolog:At4g30890
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAACTTGGGGAATCTCTGCOvergo seq fw:CTTTACTCCAGAGATTCCTGATAA
Reverse primer:TCTGATGCATGACAAAACTTAGGOvergo seq rv: AGGCCTGCCAGATAAGTTATCAGG
Tm:60.2Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5483Mimulus unigene:MlU3564Phytome id:
 Arabidopsis homolog:At4g30890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCATCATCATATCGCAACCOvergo seq fw:
Reverse primer:GCTTGAAGGGTACAGAACAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5484Mimulus unigene:MlU3573Phytome id:
 Arabidopsis homolog:At2g31660
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATCAACTGCCAGGAGAAGCOvergo seq fw:ATGAAGCTGAGAGCCTTAGACTTC
Reverse primer:CATCATCGATTGGTGATTGCOvergo seq rv: CTAGCAGCCAGTCTCTGAAGTCTA
Tm:60.0Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5485Mimulus unigene:MlU3597Phytome id:
 Arabidopsis homolog:At3g47930
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 82.70cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGTTAGGCGACGGTAGTGGOvergo seq fw:
Reverse primer:GCACCTATTGAGCAGAGATGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5486Mimulus unigene:MlU3601Phytome id:
 Arabidopsis homolog:At2g32560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAAATTCTTTGTTTCTTCTCCOvergo seq fw:
Reverse primer:TGGACTCGATCATGTCTTGGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5487Mimulus unigene:MlU3606Phytome id:
 Arabidopsis homolog:At5g05970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTCCGTCAGTCGTAAAGGOvergo seq fw:
Reverse primer:AAACTAACGGCAGAGGTTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5488Mimulus unigene:MlU3613Phytome id:
 Arabidopsis homolog:At1g04960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTACTATTTTTAATGGGAATTCATCCOvergo seq fw:
Reverse primer:TTTTCCAGTCCAGGTTTTCCOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5489Mimulus unigene:MlU3618Phytome id:
 Arabidopsis homolog:At1g48410
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGTGGGACAGTGAACAGCOvergo seq fw:CGGGAGAAGGACTGTCTTCCACAA
Reverse primer:GCGAGACAATTCCAAGATCCOvergo seq rv: TATTCCACTGACCAACTTGTGGAA
Tm:61.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5490Mimulus unigene:MlU3625Phytome id:
 Arabidopsis homolog:At2g02560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATAGCGTCGGTGACTTGGOvergo seq fw:
Reverse primer:CCCATCGTCTTTTATTGTTCCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5491Mimulus unigene:MlU3632Phytome id:
 Arabidopsis homolog:At1g19110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTATTTTCTACGGATGCTTGCOvergo seq fw:
Reverse primer:CCAATGGGTATCTCGTTTGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5492Mimulus unigene:MlU3633Phytome id:
 Arabidopsis homolog:At5g22860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAAACATTGTGTCGTTTTCCOvergo seq fw:
Reverse primer:TCCCTCTCAGACTAGCATTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5493Mimulus unigene:MlU3634Phytome id:
 Arabidopsis homolog:At5g24260
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGTCCCTTCACGCTATCCOvergo seq fw:
Reverse primer:GCCCAATATCTCAGAAGTAAAGGOvergo seq rv:
Tm:62.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5494Mimulus unigene:MlU3655Phytome id:
 Arabidopsis homolog:At5g03340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGTCTTCATCAGCTACAACGOvergo seq fw:
Reverse primer:GCCTGCCTCAGAAAATCTCCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5495Mimulus unigene:MlU3663Phytome id:
 Arabidopsis homolog:At3g54400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTGGAGTAGCACGTGTCGOvergo seq fw:
Reverse primer:CAGCCGATAAGAATCAAAACGOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5496Mimulus unigene:MlU3670Phytome id:
 Arabidopsis homolog:At2g16430
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGATTGAGCACTCGTAGAATCGOvergo seq fw:CGGACAAGTCATTCACCGGAGTGC
Reverse primer:ATTTGCAGGTCATGTTCACGOvergo seq rv: GTTGTGAACGGAATTTGCACTCCG
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5497Mimulus unigene:MlU3687Phytome id:
 Arabidopsis homolog:At4g25440
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTTGCACGGAGAACTGCOvergo seq fw:CAAGATGAGACGGTTAGAGTTTGG
Reverse primer:GGCAGTCCCAAACTCTAACCOvergo seq rv: GACCAGATTGGCAGTCCCAAACTC
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5498Mimulus unigene:MlU3690Phytome id:
 Arabidopsis homolog:At2g01970
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCGCACAAAGAACAAAGCOvergo seq fw:CCATAAATGAACAAGCCCGTGGAT
Reverse primer:GCGTTGACATACTTTCAACTTGCOvergo seq rv: CTTTCCTATGCGGTGGATCCACGG
Tm:61.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5499Mimulus unigene:MlU3696Phytome id:
 Arabidopsis homolog:At4g33150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTCTGGAGCACTGACTTCCOvergo seq fw:
Reverse primer:GACCGACTTGACACTTCACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5500Mimulus unigene:MlU3698Phytome id:
 Arabidopsis homolog:At3g57650
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCTGCTGTAGTGATTCTGCOvergo seq fw:CAGCTGGATTACCTGTTCCAAGAA
Reverse primer:AAAGCCAGATAAGCTCCAACCOvergo seq rv: CGAGGGATCAGAACGTTTCTTGGA
Tm:59.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5501Mimulus unigene:MlU3704Phytome id:
 Arabidopsis homolog:At1g72550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACAAGACCGTGTATCAGCOvergo seq fw:
Reverse primer:CAACTGCGGCAATAAATGGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5502Mimulus unigene:MlU3706Phytome id:
 Arabidopsis homolog:At5g04930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAATTTCTCCATTTCTCTTGCOvergo seq fw:
Reverse primer:CAATGTTGGACACGTTTTGGOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5503Mimulus unigene:MlU3710Phytome id:
 Arabidopsis homolog:At1g77680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCGAGTGGCCTAAATTTGCOvergo seq fw:
Reverse primer:CGAGACTCTCAGGGTTGTGGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5504Mimulus unigene:MlU3715Phytome id:
 Arabidopsis homolog:At3g10700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCATATTGGATCAGTCAGCOvergo seq fw:
Reverse primer:TGCTTCAAGCCTGAAAATGCOvergo seq rv:
Tm:58.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5505Mimulus unigene:MlU3716Phytome id:
 Arabidopsis homolog:At3g10700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGTTGCTGATGAATGAGGOvergo seq fw:
Reverse primer:AAATTTCTTGAGAAGAGCAGAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5506Mimulus unigene:MlU3722Phytome id:
 Arabidopsis homolog:At3g18000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGATGCTCGATTCGAAAGCOvergo seq fw:
Reverse primer:CATCAGCGCACATAAATTCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5507Mimulus unigene:MlU3727Phytome id:
 Arabidopsis homolog:At2g35060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTGTTTGCTGACCTAGCOvergo seq fw:
Reverse primer:CGTAAGCATTTCCGATTTGGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5508Mimulus unigene:MlU3728Phytome id:
 Arabidopsis homolog:At2g35060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCCTCGCCCTAACTACCGOvergo seq fw:
Reverse primer:CACATGTTCCGTTGTGTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5509Mimulus unigene:MlU3770Phytome id:
 Arabidopsis homolog:At1g09020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGCCTATGAGTTGCTTCCOvergo seq fw:
Reverse primer:AATCCAGTACGCTGAGAACTCCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5510Mimulus unigene:MlU3780Phytome id:
 Arabidopsis homolog:At3g01090
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGACCCTGAACTCTCTGCOvergo seq fw:TTGAGAACTTCCGTCATTATCTCA
Reverse primer:CATCCTCGTGAGATAATGACGOvergo seq rv: CACGAGCCCATCCTCGTGAGATAA
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5511Mimulus unigene:MlU3782Phytome id:
 Arabidopsis homolog:At1g56110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCCTCAACTTGCTCACGOvergo seq fw:
Reverse primer:AATTTGGCTGCATTGATTGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5512Mimulus unigene:MlU3784Phytome id:
 Arabidopsis homolog:At1g52150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTCGAGCCTGTAGCAGAAGGOvergo seq fw:
Reverse primer:TCATTCAGCACTTTCCAAGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5513Mimulus unigene:MlU3786Phytome id:
 Arabidopsis homolog:At3g56440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCACTGACCATTCTGAGCOvergo seq fw:
Reverse primer:GGAAACGTTGGGAGTAAGAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5514Mimulus unigene:MlU3809Phytome id:
 Arabidopsis homolog:At5g46340
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAGTTGGCCAGTCCATCCOvergo seq fw:GAGGTCTCACTAAATCAGCATCTG
Reverse primer:CAGTCTGATGGCGGTTTAGGOvergo seq rv: GGACTGGCCAACTTTGCAGATGCT
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5515Mimulus unigene:MlU3813Phytome id:
 Arabidopsis homolog:At5g11650
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCAGGCTCAAAAAGAAGGOvergo seq fw:
Reverse primer:GGGCATCATATTGACTTCACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5516Mimulus unigene:MlU3817Phytome id:
 Arabidopsis homolog:At5g30510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGCCAATATCAACTGTGGOvergo seq fw:
Reverse primer:TGAGACCGTGAATGGATGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5517Mimulus unigene:MlU3818Phytome id:
 Arabidopsis homolog:At5g30510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCTTCTGCTTGAGCTATCCOvergo seq fw:
Reverse primer:AGTCCTCAGTAACCGCAAGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5518Mimulus unigene:MlU3825Phytome id:
 Arabidopsis homolog:At1g11910
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 6.10cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTCCACCGATTGTGAGGOvergo seq fw:GCTGCTTCAGCAAACCCAACTCTC
Reverse primer:GCTCCCAAGTTGGATTATGCOvergo seq rv: TCGATTATGGAAAACTGAGAGTTG
Tm:61.0Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5519Mimulus unigene:MlU3836Phytome id:
 Arabidopsis homolog:At5g15080
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGGCTCCAAAGTGGATAGCOvergo seq fw:GGCTCCAAAGTGGATAGCTCTGTT
Reverse primer:AACTTTCGGAGCTGAGAAGCOvergo seq rv: GTGAGCTAGAACCACTAACAGAGC
Tm:59.8Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5520Mimulus unigene:MlU3841Phytome id:
 Arabidopsis homolog:At5g48300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCTCTTGCTGCCTCTTGCOvergo seq fw:
Reverse primer:CCTTCCAAAATGCTCAATGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5521Mimulus unigene:MlU3854Phytome id:
 Arabidopsis homolog:At3g48000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCCACGGGTTAACAATGCOvergo seq fw:
Reverse primer:TTACCGGTATCGGTTGATCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5522Mimulus unigene:MlU3856Phytome id:
 Arabidopsis homolog:At5g53850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCTGCCGTCAATTCTACCOvergo seq fw:
Reverse primer:CCATCATCCTTTCCTTCTGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5523Mimulus unigene:MlU3863Phytome id:
 Arabidopsis homolog:At5g28840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGTGGGGAGATGGTTTGCOvergo seq fw:
Reverse primer:CGATTCCATGAGCTTTCTCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5524Mimulus unigene:MlU3869Phytome id:
 Arabidopsis homolog:At2g31740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAAATGGGACTTTTGATGCOvergo seq fw:
Reverse primer:AAGTCTGTTGTTTGGTGGTTCCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5525Mimulus unigene:MlU3876Phytome id:
 Arabidopsis homolog:At1g23800
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 55.10cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGCCACCTGTTAGTGTGCOvergo seq fw:CTGCTCGCAGAATTTCAGCTCTTC
Reverse primer:AAAAAGCCGAACAAACATCGOvergo seq rv: GGAACGGAGCTAGAAAGAAGAGCT
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5526Mimulus unigene:MlU3877Phytome id:
 Arabidopsis homolog:At1g23800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTTTCCCTTCCGATTCCOvergo seq fw:
Reverse primer:TCTGGAGCCACTCTTGAAGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5527Mimulus unigene:MlU3880Phytome id:
 Arabidopsis homolog:At4g34450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCATCCTCGGATCTCACTGCOvergo seq fw:
Reverse primer:ATGATGATGGTGTGGAAGACGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5528Mimulus unigene:MlU3882Phytome id:
 Arabidopsis homolog:At1g67580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACCAGTGCCTAATTCACCOvergo seq fw:
Reverse primer:GGTTCACCTGTACTTTCTGATGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5529Mimulus unigene:MlU3892Phytome id:
 Arabidopsis homolog:At3g63520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATCGATTACGTTCACTGCOvergo seq fw:
Reverse primer:GGGTCAATGAAAGCTACACTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5530Mimulus unigene:MlU3894Phytome id:
 Arabidopsis homolog:At4g00290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCAGCAGTTTTCGATTGGOvergo seq fw:
Reverse primer:GCATGGACGTTATATCCTCTCGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5531Mimulus unigene:MlU3896Phytome id:
 Arabidopsis homolog:At5g19600
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCAACGAACAATAATGTGGOvergo seq fw:CGCGACATGCAAGCTCGGGAATAT
Reverse primer:CTCGCCATGTACAACAATGCOvergo seq rv: AAGATTCGATTCCGGAATATTCCC
Tm:58.9Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5532Mimulus unigene:MlU3907Phytome id:
 Arabidopsis homolog:At4g30780
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGCGAAGTGTTATTTTGCOvergo seq fw:CGAATTTTCCGGCTTCTGTTTTGA
Reverse primer:TTAAGACGCATGTCACACTGGOvergo seq rv: TCCCAGCTGCCAATTCTCAAAACA
Tm:58.3Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5533Mimulus unigene:MlU3916Phytome id:
 Arabidopsis homolog:At1g16350
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTCTGAGCAGGCATCCOvergo seq fw:CGACGAATTCTCTTCCTCGCCCTG
Reverse primer:CAACGTCATCACTCGTCACCOvergo seq rv: TTCGGTCACAAAAATGCAGGGCGA
Tm:59.6Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5534Mimulus unigene:MlU3917Phytome id:
 Arabidopsis homolog:At1g16350
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAGATCATGAGCGGATTGGOvergo seq fw:CCCATGAACACCACCTTCCTTTTG
Reverse primer:TATAAGGTTGCGTCGATTGCOvergo seq rv: TAGAACTGGAGCAGCACAAAAGGA
Tm:60.2Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5535Mimulus unigene:MlU3920Phytome id:
 Arabidopsis homolog:At1g03910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTATTGACAATGCGGAATGCOvergo seq fw:
Reverse primer:GGAAGGTGATGTCGTATTTGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5536Mimulus unigene:MlU3929Phytome id:
 Arabidopsis homolog:At5g49960
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)1 0.70cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGGTTTCTGCTGAATGTGGOvergo seq fw:
Reverse primer:GAACATCCATAATTCCGATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5537Mimulus unigene:MlU3932Phytome id:
 Arabidopsis homolog:At4g23100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCCTCTCAAGGCCATCCOvergo seq fw:
Reverse primer:CCTTGGAGAAGGCTATGTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5538Mimulus unigene:MlU3933Phytome id:
 Arabidopsis homolog:At5g56680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACCCAACTGCTCTCAAACGOvergo seq fw:
Reverse primer:GCTTCCTCCGATAAGTTCTCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5539Mimulus unigene:MlU3935Phytome id:
 Arabidopsis homolog:At2g20900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAATTTTCTCCATTCAGCOvergo seq fw:
Reverse primer:GCATGGACTGGTTCTACTTGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5540Mimulus unigene:MlU3948Phytome id:
 Arabidopsis homolog:At4g36195
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGACAAAGGAAGAGCACTGGOvergo seq fw:
Reverse primer:CAGCCAAGTCGAAAAGTGCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5541Mimulus unigene:MlU3949Phytome id:
 Arabidopsis homolog:At4g36195
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGCAATCCTTTGCATCGOvergo seq fw:
Reverse primer:AAAAACGTCTTTGGGGAAGGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5542Mimulus unigene:MlU3958Phytome id:
 Arabidopsis homolog:At1g01040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCGTACCATTTATTCAGAAGTTCCOvergo seq fw:
Reverse primer:TACTGTGGAAGTATACGTGGATGGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5543Mimulus unigene:MlU3964Phytome id:
 Arabidopsis homolog:At5g37510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCCCAATTTGTGATCAGGOvergo seq fw:
Reverse primer:GCGAATATTTGAACCAACTGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5544Mimulus unigene:MlU3968Phytome id:
 Arabidopsis homolog:At4g24190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACCAATTCTTCCGTCTTGGOvergo seq fw:
Reverse primer:GAAGATAAGCAGCCGTTTGGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5545Mimulus unigene:MlU3969Phytome id:
 Arabidopsis homolog:At4g34270
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACATCTAAGGAGCCCATCCOvergo seq fw:GGGAAGACTGCCAGGAGCAAATCA
Reverse primer:TCCGTACCCTCATTGAAAGCOvergo seq rv: GTCAATGCAACAATATTGATTTGC
Tm:58.5Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5546Mimulus unigene:MlU3970Phytome id:
 Arabidopsis homolog:At2g31955
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTCTGTTTGGAGTCTTTGCOvergo seq fw:GCGATGTCGAACATCCCAGCATGA
Reverse primer:TCATCACATCGATGACAGAGCOvergo seq rv: AAAGAAAGAAAGCGGCTCATGCTG
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5547Mimulus unigene:MlU3974Phytome id:
 Arabidopsis homolog:At5g36230
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTTCGAGCTCAAGCTTTCCOvergo seq fw:CCAGCCATTTTACAAAGGGCTCCA
Reverse primer:CCAGCTAGCAGAGGAAGTCGOvergo seq rv: TCGTTTGTGAAGGCGTTGGAGCCC
Tm:58.8Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5548Mimulus unigene:MlU3976Phytome id:
 Arabidopsis homolog:At5g65700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCTCTCGCATGGTTGGOvergo seq fw:
Reverse primer:GAGTTTCGAGGCTCATGTGGOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5549Mimulus unigene:MlU3979Phytome id:
 Arabidopsis homolog:At5g17990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTGGATGGTGCTGATGAGGOvergo seq fw:
Reverse primer:GCACTTCCACAAGCAGACGOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5550Mimulus unigene:MlU3980Phytome id:
 Arabidopsis homolog:At5g17990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGCAAGATCGACTCCTTCGOvergo seq fw:
Reverse primer:AAAGTTTTGGCATGAAAAGAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5551Mimulus unigene:MlU3987Phytome id:
 Arabidopsis homolog:At5g15400
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 20.80cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTGTGTTCAAGCCTTCTCCOvergo seq fw:CACATCGGGTATTAGCATGTCAGC
Reverse primer:CAAAATTGCTGCTTCAGACGOvergo seq rv: CCGGTCTCATCTTACTGCTGACAT
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5552Mimulus unigene:MlU3989Phytome id:
 Arabidopsis homolog:At4g16155
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGATAGGGTTGGATGAGCOvergo seq fw:
Reverse primer:CATCCTGAAATTAGTATGGTTGGOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5553Mimulus unigene:MlU3995Phytome id:
 Arabidopsis homolog:At3g26990
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATAATTCACCGCAAAAAGGOvergo seq fw:CTGGGGAAGTCTCCTCCCATCAAC
Reverse primer:GGTGGAATCTCTCTTCATCACCOvergo seq rv: TCGAATTCTTCACATTGTTGATGG
Tm:58.2Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5554Mimulus unigene:MlU3998Phytome id:
 Arabidopsis homolog:At5g64440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGGATGGAGTCCCGATAGCOvergo seq fw:
Reverse primer:AATCCTGCAGCTACCACTGCOvergo seq rv:
Tm:62.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5555Mimulus unigene:MlU3999Phytome id:
 Arabidopsis homolog:At5g64440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGTCCTCTACCGTGTATGCOvergo seq fw:
Reverse primer:TCGCCACCTACCTAGAGACGOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5556Mimulus unigene:MlU4000Phytome id:
 Arabidopsis homolog:At1g75850
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACCTAATAATTGGGACTCTGCOvergo seq fw:CCAGGGGTAGCAGTGGGCCTGTAA
Reverse primer:GTTACAGGCCCACTGCTACCOvergo seq rv: ATTTCAACAAAGAGTGTTACAGGC
Tm:59.5Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5557Mimulus unigene:MlU4008Phytome id:
 Arabidopsis homolog:At4g31570
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGCAAGGTATTGGAACAGGOvergo seq fw:GCAGCAGAAAGTTAACTCACTGAC
Reverse primer:TCATCTGGGTAACTGCTAGTGCOvergo seq rv: TGCAGCCAGTGCATCTGTCAGTGA
Tm:59.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5558Mimulus unigene:MlU4017Phytome id:
 Arabidopsis homolog:At1g09210
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGTGGAACTGCACATCTGGOvergo seq fw:
Reverse primer:CCCCGTTGTAAGTGAGAATAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5559Mimulus unigene:MlU4032Phytome id:
 Arabidopsis homolog:At4g24550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATCAACTTGTCCCCTTCCOvergo seq fw:
Reverse primer:TTTCCTCCCTCTTCCTACCCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5560Mimulus unigene:MlU4033Phytome id:
 Arabidopsis homolog:At4g24550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCACTCGAGTCTCTTCTGCOvergo seq fw:
Reverse primer:GAGTTTCCTTCAAACATCACAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5561Mimulus unigene:MlU4046Phytome id:
 Arabidopsis homolog:At4g04910
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 7.50cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACCTTGTTCACCCTGAGCOvergo seq fw:
Reverse primer:GAGATGCATTCGCACTTACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5562Mimulus unigene:MlU4052Phytome id:
 Arabidopsis homolog:At5g55060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACCTTTGCTTACTGAAGACCOvergo seq fw:
Reverse primer:AAAATCGCCACAGTCAGAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5563Mimulus unigene:MlU4054Phytome id:
 Arabidopsis homolog:At1g04920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGATGTTCCCGATATTTACCOvergo seq fw:
Reverse primer:TTCTTCAAGCCGTTTCTTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5564Mimulus unigene:MlU4055Phytome id:
 Arabidopsis homolog:At1g04920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTTTTAGAGAGTTGCCTAATTACCOvergo seq fw:
Reverse primer:AAAGTGGATGATATGAGACAAAAGCOvergo seq rv:
Tm:57.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5565Mimulus unigene:MlU4061Phytome id:
 Arabidopsis homolog:At5g11860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATCGGTATTCCGTTGTCCOvergo seq fw:
Reverse primer:ATGTCCTTGACCCAAAGAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5566Mimulus unigene:MlU4070Phytome id:
 Arabidopsis homolog:At1g31660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAAACCTGTCTTCTTCAATCGOvergo seq fw:
Reverse primer:TGGCATCAGTCTCTTCTTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5567Mimulus unigene:MlU4073Phytome id:
 Arabidopsis homolog:At5g56360
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)5+8 58.30cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTTGGTTCATCAACATCCOvergo seq fw:GAGGCGGATCCTTGTTCAACGAGT
Reverse primer:GTCTGCCCTTTCAAACAAGCOvergo seq rv: CTGCAAGATAAGTTGGACTCGTTG
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):MgFPC1694, MgFPC249, MgFPC95, MlFPC39, MlFPC780
    
MlSTS5568Mimulus unigene:MlU4087Phytome id:
 Arabidopsis homolog:At4g34640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGGTTTAAGGTTCCAGAGTCCOvergo seq fw:
Reverse primer:ATGGCAATTGGGACATTAGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5569Mimulus unigene:MlU4088Phytome id:
 Arabidopsis homolog:At1g69830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAACATATTTGGAGGGAAGCOvergo seq fw:
Reverse primer:GAGAAACCTCTTGCGAAGTCCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5570Mimulus unigene:MlU4089Phytome id:
 Arabidopsis homolog:At1g76130
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTGTTTCGCCAGTTTTCGOvergo seq fw:TGGAATATTTTTATCGGGCTGCGG
Reverse primer:TCGAGCTGTCACATTCTTGGOvergo seq rv: GGTCTGGAATCCACTGCCGCAGCC
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5571Mimulus unigene:MlU4090Phytome id:
 Arabidopsis homolog:At1g51980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTTCGGTTGGTTGACAGGOvergo seq fw:
Reverse primer:GATTTCCCAATCCAAAAAGGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5572Mimulus unigene:MlU4091Phytome id:
 Arabidopsis homolog:At3g16480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGCTAACCGCATCATAGCOvergo seq fw:
Reverse primer:ATCGTGCCAAAAATTCAACGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5573Mimulus unigene:MlU4100Phytome id:
 Arabidopsis homolog:At3g22200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAAATAAGCTGCCACTCCOvergo seq fw:
Reverse primer:CCTGTATCGTGTGCTGTTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5574Mimulus unigene:MlU4101Phytome id:
 Arabidopsis homolog:At5g35910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGAGACTTTGGCATTTACGOvergo seq fw:
Reverse primer:ATTCCAGGCTGAACCTTTCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5575Mimulus unigene:MlU4109Phytome id:
 Arabidopsis homolog:At4g26770
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTCTTGCTCGTCAAATCCOvergo seq fw:
Reverse primer:AATATCGGTGTTGCCAGTGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5576Mimulus unigene:MlU4120Phytome id:
 Arabidopsis homolog:At5g41800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTTGCGTCGTTAGGATGGOvergo seq fw:
Reverse primer:TGTCCTCCCAGGAGAGTGGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5577Mimulus unigene:MlU4121Phytome id:
 Arabidopsis homolog:At1g08230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTGAGACCCCTCTTTGACGOvergo seq fw:
Reverse primer:TGGGTATTGGGCATTTGGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5578Mimulus unigene:MlU4122Phytome id:
 Arabidopsis homolog:At3g13050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTCATCTGGGCAAGAAAGCOvergo seq fw:
Reverse primer:CATACGAAAGAGGACCAACGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5579Mimulus unigene:MlU4123Phytome id:
 Arabidopsis homolog:At5g20350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGGCATGCACTGTTCTGGOvergo seq fw:
Reverse primer:GGAAAGTTTGCCAAGGAAGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5580Mimulus unigene:MlU4124Phytome id:
 Arabidopsis homolog:At5g20350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTTGCATCATCCCAATTCCOvergo seq fw:
Reverse primer:CTTTGGTGCATGGTTGAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5581Mimulus unigene:MlU4126Phytome id:
 Arabidopsis homolog:At5g36160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGCAGAAATCCGTATCATCCOvergo seq fw:
Reverse primer:GGAATCCTGATGAAGCAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):