Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1200 - 1299) out of 1979 markers

MlSTS5382Mimulus unigene:MlU2964Phytome id:
 Arabidopsis homolog:At1g47240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGAAATAAGATATACCACAAATGCOvergo seq fw:
Reverse primer:CTCTAGATGTGCTGAATGAATGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5383Mimulus unigene:MlU2981Phytome id:
 Arabidopsis homolog:At2g01970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATAAAGCAGCACGGAAACCOvergo seq fw:
Reverse primer:TGTGGCGTTGACATACTTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5384Mimulus unigene:MlU2986Phytome id:
 Arabidopsis homolog:At5g14060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAACATTCACACCGTTTGCOvergo seq fw:
Reverse primer:TGGTCAATTTGGTTTTCTTGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5385Mimulus unigene:MlU2988Phytome id:
 Arabidopsis homolog:At1g60780
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCTGAAACAGTGAAATACGGOvergo seq fw:CTCGTATAGGAGCCTTTCTTTCAG
Reverse primer:GGCCAGGAGTCAGTTCAAGGOvergo seq rv: TCTGAGGAATCAGGCCCTGAAAGA
Tm:59.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5386Mimulus unigene:MlU2992Phytome id:
 Arabidopsis homolog:At2g38400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCCACCTTTCCCTATCAGCOvergo seq fw:
Reverse primer:GTTACGACTCCCGAGATTGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5387Mimulus unigene:MlU2994Phytome id:
 Arabidopsis homolog:At3g19820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACCTCCTTCTCGGTCTTCCOvergo seq fw:
Reverse primer:ATTCGTCCACAAGGAAATGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5388Mimulus unigene:MlU2995Phytome id:
 Arabidopsis homolog:At4g01100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGCTGACTCCTTTGTTACGOvergo seq fw:
Reverse primer:GCGAGCCTTGTTATGACACCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5389Mimulus unigene:MlU2997Phytome id:
 Arabidopsis homolog:At2g36190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCAAAACTCTCCACTACCGOvergo seq fw:
Reverse primer:AAGGAGGATTAGGACCATTCGOvergo seq rv:
Tm:57.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5390Mimulus unigene:MlU2999Phytome id:
 Arabidopsis homolog:At5g11560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCAGAGAACAGCGTTTGCOvergo seq fw:
Reverse primer:CTTCCTGATCTGCTGTCACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5391Mimulus unigene:MlU3000Phytome id:
 Arabidopsis homolog:At5g11560
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAAAATTGCCACAACAAGGOvergo seq fw:
Reverse primer:CAAAGGCATAACTCCCAAGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5392Mimulus unigene:MlU3003Phytome id:
 Arabidopsis homolog:At5g17310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAAATACGGGTGTAATGTGCOvergo seq fw:
Reverse primer:AGGAAACACATCTCCATGACCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5393Mimulus unigene:MlU3017Phytome id:
 Arabidopsis homolog:At3g11830
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACAATTGTCTCGGGATTACCOvergo seq fw:CATCAACACTCAAGACAAGGCAAG
Reverse primer:TGCAATTATGATTGTTCGAAGGOvergo seq rv: GCAGCTACAGAAGCAGCTTGCCTT
Tm:59.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5394Mimulus unigene:MlU3026Phytome id:
 Arabidopsis homolog:At5g06600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAAAAAGGAGAAGGCTGAGGOvergo seq fw:
Reverse primer:AGAAGCGCTGAAACTGAACCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5395Mimulus unigene:MlU3027Phytome id:
 Arabidopsis homolog:At3g11910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACAGGTTTCTCGTATGTGTGCOvergo seq fw:
Reverse primer:CAAAAGAAGCTGCGTGTTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5396Mimulus unigene:MlU3031Phytome id:
 Arabidopsis homolog:At1g56310
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATGTCTTTCCTGCGTATTGCOvergo seq fw:
Reverse primer:GCATCAAGAGCAGCATATTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5397Mimulus unigene:MlU3037Phytome id:
 Arabidopsis homolog:At5g49810
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGTGAAACGGCAGTAACCOvergo seq fw:TAGAATCGATACACCTGCTTGAGC
Reverse primer:ACAGAGATCGTGGGAAGTCGOvergo seq rv: GTGGGAGGTACTCGAAGCTCAAGC
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5398Mimulus unigene:MlU3040Phytome id:
 Arabidopsis homolog:At3g24503
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGATGGCCGACATTCCOvergo seq fw:AGTGCTTAATGTCGTAACGGGATA
Reverse primer:CGACATTAAGCACTCCATCCOvergo seq rv: ACCGGCAGAATGACCGTATCCCGT
Tm:59.0Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5399Mimulus unigene:MlU3041Phytome id:
 Arabidopsis homolog:At3g24503
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTCATGACGGACATTACAGGOvergo seq fw:GCTTACCACCTGTTAACAAAGTGG
Reverse primer:GTTGGTGATCCTTTCGATCCOvergo seq rv: GGAAAGAAGGAAGGCGCCACTTTG
Tm:58.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5400Mimulus unigene:MlU3060Phytome id:
 Arabidopsis homolog:At5g63960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACAGTGCATGGAGGTTACGOvergo seq fw:
Reverse primer:TCTCCAGCTTATCAAATTTCTGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5401Mimulus unigene:MlU3070Phytome id:
 Arabidopsis homolog:At1g69830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTACCGACCAATTTTCTGCOvergo seq fw:
Reverse primer:AACCTCCGGGAGTGATGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5402Mimulus unigene:MlU3073Phytome id:
 Arabidopsis homolog:At1g79830
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGAAGGGCTGAAGCTTGGOvergo seq fw:AAAGCACAAGGAGGAGCTGCATGA
Reverse primer:CTCCTCCTTGTGCTTTCTCCOvergo seq rv: TTGGTGCACCAAAGCTTCATGCAG
Tm:61.1Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5403Mimulus unigene:MlU3074Phytome id:
 Arabidopsis homolog:At1g79830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTAATTCTGCTCGCATTCCOvergo seq fw:
Reverse primer:AGCTGCACTTCGTCAAAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5404Mimulus unigene:MlU3098Phytome id:
 Arabidopsis homolog:At4g20910
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATCTGCGATGCAAAACCOvergo seq fw:GAGAATCAAATTTCGTGATGGAGC
Reverse primer:TATACGATGGCTCCATCACGOvergo seq rv: GCAGTGCTATACGATGGCTCCATC
Tm:60.2Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5405Mimulus unigene:MlU3108Phytome id:
 Arabidopsis homolog:At1g01710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCTTTTCATCCTTTTCACGOvergo seq fw:
Reverse primer:TCACGAATCAGACAAAGACTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5406Mimulus unigene:MlU3110Phytome id:
 Arabidopsis homolog:At3g55870
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGTTGACACTCCAAATGCOvergo seq fw:
Reverse primer:ATCTAACCGGATGGGATGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5407Mimulus unigene:MlU3124Phytome id:
 Arabidopsis homolog:At4g34450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCATCCTCGGATCTCACTGCOvergo seq fw:
Reverse primer:ATGATGATGGTGTGGAAGACGOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5408Mimulus unigene:MlU3125Phytome id:
 Arabidopsis homolog:At5g51820
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACATCCGTGAGAAAGATGGOvergo seq fw:GTGCCACTAGAAGATTTTGGACAT
Reverse primer:TGCAATTATTGACATCCAAGCOvergo seq rv: TGGGGTCTGGATGACCATGTCCAA
Tm:59.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5409Mimulus unigene:MlU3126Phytome id:
 Arabidopsis homolog:At5g51820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAAATATGATCCTCGATCCOvergo seq fw:
Reverse primer:TTCCGATGTTGTGACTGAGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5410Mimulus unigene:MlU3132Phytome id:
 Arabidopsis homolog:At4g38220
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAACCCTTCTCTCCCATCCOvergo seq fw:CACTTTCAAGAGTATGAACGTGGG
Reverse primer:TAAAGTCTAGCCCCGTGACCOvergo seq rv: CTCGTCCAGCACAATGCCCACGTT
Tm:59.5Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5411Mimulus unigene:MlU3140Phytome id:
 Arabidopsis homolog:At4g39370
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCGAAAGTTGATGGTTGCOvergo seq fw:
Reverse primer:GCGAAAGGTGTAAGCTGTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5412Mimulus unigene:MlU3146Phytome id:
 Arabidopsis homolog:At4g30200
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCAGCTCTTGGAGAAAGCOvergo seq fw:GACTATCCCGCAGAGCCAACTTGT
Reverse primer:CACCACTTTCCCCATATTCGOvergo seq rv: CCGGTTTCAACAAATGACAAGTTG
Tm:59.5Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5413Mimulus unigene:MlU3165Phytome id:
 Arabidopsis homolog:At5g65470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTTTATGCCCTTCGACAACCOvergo seq fw:
Reverse primer:CAGGTGCCCTTTGACTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5414Mimulus unigene:MlU3176Phytome id:
 Arabidopsis homolog:At1g09795
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTGGAATTGTTGGTTTGGOvergo seq fw:
Reverse primer:ACTGTGGCATCTGAGCAAGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5415Mimulus unigene:MlU3208Phytome id:
 Arabidopsis homolog:At1g54100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATCACTTCCAGCTTCACGOvergo seq fw:
Reverse primer:GCGGCAAAGTTATTGAGTCCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5416Mimulus unigene:MlU3212Phytome id:
 Arabidopsis homolog:At4g24330
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGCCTTAGTCATCTTGAGCOvergo seq fw:
Reverse primer:CAGGTTTTTGGTGACAAAGCOvergo seq rv:
Tm:57.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5417Mimulus unigene:MlU3213Phytome id:
 Arabidopsis homolog:At5g08430
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGAATTAAAGCTGGCTTGCOvergo seq fw:
Reverse primer:CGCCATCCTTTCTCATTAGCOvergo seq rv:
Tm:57.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5418Mimulus unigene:MlU3215Phytome id:
 Arabidopsis homolog:At5g47540
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGCTTTGTCTGCCTCAAACGOvergo seq fw:
Reverse primer:GCTCGATCGATCAAATACTGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5419Mimulus unigene:MlU3221Phytome id:
 Arabidopsis homolog:At1g67680
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTTGCTCACTGATTGAAAGGOvergo seq fw:GGAACAAGATTAAAGATGCAGAGC
Reverse primer:AGGTTGCTTAATGCCACTGCOvergo seq rv: GCTGACAGCAACAGTTGCTCTGCA
Tm:60.0Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5420Mimulus unigene:MlU3225Phytome id:
 Arabidopsis homolog:At2g28450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCCTTTGCCTCTTACAGCOvergo seq fw:
Reverse primer:TATTGTCCCAGTCCCACAGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5421Mimulus unigene:MlU3226Phytome id:
 Arabidopsis homolog:At2g28450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGTGTGAGGAAAAAGATCGOvergo seq fw:
Reverse primer:TTCAAAAATGTTGTTGCTATAGTGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5422Mimulus unigene:MlU3227Phytome id:
 Arabidopsis homolog:At2g37940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGATGCTTTATGGCTGTGGOvergo seq fw:
Reverse primer:AGACCCATTCGAACGATCCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5423Mimulus unigene:MlU3228Phytome id:
 Arabidopsis homolog:At3g13600
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGTTCTGGAAAGATGATCCOvergo seq fw:
Reverse primer:GCTCTGGTTCTTGCTCTTGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5424Mimulus unigene:MlU3231Phytome id:
 Arabidopsis homolog:At4g25970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCCTTTCTGGACATAGTCACCOvergo seq fw:
Reverse primer:TTCCATGTTCCTGTTTCTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5425Mimulus unigene:MlU3232Phytome id:
 Arabidopsis homolog:At4g33490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGATTTTCCCCGTTTCTGGOvergo seq fw:
Reverse primer:CATCACTCCCAAAGATGAACCOvergo seq rv:
Tm:61.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5426Mimulus unigene:MlU3239Phytome id:
 Arabidopsis homolog:At5g16150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGTTGTTAGCACACTTCTCGOvergo seq fw:
Reverse primer:AAGGCAAACCAGCTACTAATGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5427Mimulus unigene:MlU3240Phytome id:
 Arabidopsis homolog:At5g16150
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGCCCAATCACAAAGTTCGOvergo seq fw:
Reverse primer:TCACTGATGGACAAGCAAGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5428Mimulus unigene:MlU3248Phytome id:
 Arabidopsis homolog:At3g57890
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCTCAAGCTGACGAAGAGGOvergo seq fw:
Reverse primer:GAACTTGTGCCAACATCAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5429Mimulus unigene:MlU3249Phytome id:
 Arabidopsis homolog:At3g57890
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGTTTCCCTCAAAATCTGCOvergo seq fw:GGGCACTTGATAATTCTCGTTTGC
Reverse primer:TGAATCAAGTTGGTGTTGACCOvergo seq rv: CAACTCGAAGAGAGCCGCAAACGA
Tm:59.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5430Mimulus unigene:MlU3257Phytome id:
 Arabidopsis homolog:At3g09090
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGCATCCCTTCTTGAGGOvergo seq fw:CCCTTCTTCATCTCGGAGAGTACG
Reverse primer:CCCAACGATATAATCGACAAGGOvergo seq rv: TGTTACTCCATCGTCACGTACTCT
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5431Mimulus unigene:MlU3266Phytome id:
 Arabidopsis homolog:At3g19980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGCCAAATTATTGTTACCGOvergo seq fw:
Reverse primer:GAAATATGGTACTCCAGTTCTTGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5432Mimulus unigene:MlU3279Phytome id:
 Arabidopsis homolog:At5g64760
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGTCTCCTTGTGAATTTGGOvergo seq fw:CTTGGCTGATTGGAAACAGATCAC
Reverse primer:CATGCTTGGTGGTTCTTTGGOvergo seq rv: CGACAGACCAATGGGTGTGATCTG
Tm:58.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5433Mimulus unigene:MlU3292Phytome id:
 Arabidopsis homolog:At4g10040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTCACACCGTCGACAAAGGOvergo seq fw:
Reverse primer:CACAGCCATGTTTTTGTTGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5434Mimulus unigene:MlU3298Phytome id:
 Arabidopsis homolog:At1g08200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTACTGAAGTAGCTTTCTTTATCGOvergo seq fw:
Reverse primer:ATCCAGCGAGGGCTAATGGOvergo seq rv:
Tm:57.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5435Mimulus unigene:MlU3300Phytome id:
 Arabidopsis homolog:At5g03280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACAGTCGACGCTTGTACCGOvergo seq fw:
Reverse primer:GGCAAGTAGATCTCATCGTAAGCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5436Mimulus unigene:MlU3310Phytome id:
 Arabidopsis homolog:At2g37980
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGCTGGTGAAATCTACGGOvergo seq fw:
Reverse primer:ACATCCAGGAAAAGGATTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5437Mimulus unigene:MlU3311Phytome id:
 Arabidopsis homolog:At2g27900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACAAATATGCGAGATTGATGCOvergo seq fw:
Reverse primer:TGACGCACTCAAAGATGTCGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5438Mimulus unigene:MlU3312Phytome id:
 Arabidopsis homolog:At2g27900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGCCCTTCATCAGTACACCOvergo seq fw:
Reverse primer:GGGAGGTGAAAGAGCTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5439Mimulus unigene:MlU3322Phytome id:
 Arabidopsis homolog:At1g44350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGAACTCGACACGAAATGGOvergo seq fw:
Reverse primer:GCAGTCATCAGTTTGCAAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5440Mimulus unigene:MlU3326Phytome id:
 Arabidopsis homolog:At1g15690
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCTGATGTGTCCTTCAGAGGOvergo seq fw:TCCTATCACAGCTGCCTTGTGTGG
Reverse primer:ACCGGTAAACCCGACTATGCOvergo seq rv: TCCTAAAGGATCCGAACCACACAA
Tm:60.2Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5441Mimulus unigene:MlU3344Phytome id:
 Arabidopsis homolog:At2g39730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGTATAAGCAAGAGCCATCGOvergo seq fw:
Reverse primer:AAGCTCGTCGACACCTTCCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5442Mimulus unigene:MlU3350Phytome id:
 Arabidopsis homolog:At1g76510
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAACTCGGACAAGGAGACGOvergo seq fw:AACCTTGCATAGCACGAGCAGCAG
Reverse primer:TTAGTCCCAGGGCTGTTACGOvergo seq rv: AGGGCTAAAAGAGATGCTGCTGCT
Tm:62.1Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5443Mimulus unigene:MlU3351Phytome id:
 Arabidopsis homolog:At1g63680
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTGAGAGGGATTGAAGAGGOvergo seq fw:
Reverse primer:AGCATGTCATCCAAGATGTCCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5444Mimulus unigene:MlU3356Phytome id:
 Arabidopsis homolog:At1g20200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGGATCTGATGTGCATTCGOvergo seq fw:
Reverse primer:TCTGTTCAGGTTCCTCAGACGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5445Mimulus unigene:MlU3369Phytome id:
 Arabidopsis homolog:At3g28730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATATCGCTAGCGGATGTTGCOvergo seq fw:
Reverse primer:CGCAAAAATGAGAGATGAAGCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5446Mimulus unigene:MlU3377Phytome id:
 Arabidopsis homolog:At5g64220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACTGTTGTCTTGGATCTCAGCOvergo seq fw:
Reverse primer:TCTGGTCAGTGGGAATATTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5447Mimulus unigene:MlU3379Phytome id:
 Arabidopsis homolog:At1g80830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTCCTGGATTTCTTGTTTCCOvergo seq fw:
Reverse primer:ATGTCACATGCGACGATAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5448Mimulus unigene:MlU3382Phytome id:
 Arabidopsis homolog:At5g07920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACCAAGTGGCTCCTCTGCOvergo seq fw:
Reverse primer:ATCCATGCATGACAAAGTGCOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5449Mimulus unigene:MlU3412Phytome id:
 Arabidopsis homolog:At2g23820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATCACATGTACCGGATGGOvergo seq fw:
Reverse primer:TCCACAAATCGCTGATCTCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5450Mimulus unigene:MlU3413Phytome id:
 Arabidopsis homolog:At5g42180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAACGCCTCGTAAAACTCCOvergo seq fw:
Reverse primer:TTTCTTTGGATGATCTTGTTGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5451Mimulus unigene:MlU3415Phytome id:
 Arabidopsis homolog:At3g13750
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTTCATAACATTCGGACACGOvergo seq fw:CTCAACGGCTTACTGACTTTTCCT
Reverse primer:AAGCCGTTGAGACCTAAAGCOvergo seq rv: GGCAGATGCAATCGTCAGGAAAAG
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5452Mimulus unigene:MlU3422Phytome id:
 Arabidopsis homolog:At1g07910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGCTCATCGTCTTCTTTCCOvergo seq fw:
Reverse primer:GCGTTCTTCAGCAATCTTCCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5453Mimulus unigene:MlU3430Phytome id:
 Arabidopsis homolog:At1g64720
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAATATAACCGCCTTCGOvergo seq fw:GACGCCCAATGATGTATTCTCTGT
Reverse primer:TATTCCAGTTGGTGCATTCGOvergo seq rv: CCGTTCTTTTGTAGCGACAGAGAA
Tm:60.4Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5454Mimulus unigene:MlU3435Phytome id:
 Arabidopsis homolog:At5g28350
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCATGGTTACGTTGTACGCOvergo seq fw:
Reverse primer:GATATGGAAGTGCTCGTTTGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5455Mimulus unigene:MlU3436Phytome id:
 Arabidopsis homolog:At3g21280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGCTGGTTTAATGAATCTGGOvergo seq fw:
Reverse primer:GGCGAATTGAGGATACTTGCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5456Mimulus unigene:MlU3437Phytome id:
 Arabidopsis homolog:At1g51710
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACATAATGCCCAGAATCAGCOvergo seq fw:
Reverse primer:GAGATGAAGAAGGCAAGAAGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5457Mimulus unigene:MlU3445Phytome id:
 Arabidopsis homolog:At1g62660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAATGGTACGACATCAACGOvergo seq fw:
Reverse primer:CTCCGTCTCGTAAACCATCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5458Mimulus unigene:MlU3447Phytome id:
 Arabidopsis homolog:At2g47510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTTCAAACGAAGCAGAGGOvergo seq fw:
Reverse primer:CATACTCCCCGAAAATGAACCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5459Mimulus unigene:MlU3453Phytome id:
 Arabidopsis homolog:At4g31480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATTAGCTCCCTCCCTTCTGCOvergo seq fw:
Reverse primer:TCCTGCTGTGTGTAGTGATGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5460Mimulus unigene:MlU3459Phytome id:
 Arabidopsis homolog:At1g10760
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACACCTTCGATGTCCTGAGCOvergo seq fw:
Reverse primer:CGTGCATTGAGCTTTATTTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5461Mimulus unigene:MlU3463Phytome id:
 Arabidopsis homolog:At1g72160
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTGGAAGCATCTTTCTCGOvergo seq fw:AAGTCGACACTTAGGCCGCCATAT
Reverse primer:TCTGGCCCATCTAAGACTGCOvergo seq rv: AACAGGTGCCTACTCAATATGGCG
Tm:59.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5462Mimulus unigene:MlU3471Phytome id:
 Arabidopsis homolog:At2g45620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGGACCCTGAAACTATGCOvergo seq fw:
Reverse primer:CCTGCCATTTTTCCATGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5463Mimulus unigene:MlU3474Phytome id:
 Arabidopsis homolog:At1g65280
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATGTGGAAGATGCAAAGGOvergo seq fw:TATACTGAAGGAGTTTCCTGCCGT
Reverse primer:TACGGACTGTCGTTCTCAGCOvergo seq rv: CTCCAAATCCCCAGCTACGGCAGG
Tm:59.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5464Mimulus unigene:MlU3475Phytome id:
 Arabidopsis homolog:At1g65280
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCCTTTGATTTCTTCTTCGOvergo seq fw:
Reverse primer:CTTCAGACAGAGCTCAGAAAGCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5465Mimulus unigene:MlU3477Phytome id:
 Arabidopsis homolog:At4g32140
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGGGTTTGATGTTAATTGCOvergo seq fw:GCGGTGGTTGTTATTTGGGTCACA
Reverse primer:TCGTGTTCAGAAAGGTTTGCOvergo seq rv: GAGTAACCTCTGCAGATGTGACCC
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5466Mimulus unigene:MlU3478Phytome id:
 Arabidopsis homolog:At4g32140
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGACATGCCCAGTGTTGCOvergo seq fw:
Reverse primer:TGATGTGCAGAAGTTGTTTGGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5467Mimulus unigene:MlU3481Phytome id:
 Arabidopsis homolog:At5g46070
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)2+4 7.60cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGAAGCGAAAAATGCTCTCGOvergo seq fw:CTCGAGAAGGCTGCTGCAATCCAA
Reverse primer:TGTGCACTTTCTACCTTCTCACCOvergo seq rv: GATAATTTGTGCGCTCTTGGATTG
Tm:59.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5468Mimulus unigene:MlU3486Phytome id:
 Arabidopsis homolog:At2g38850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATCTTCGCTCGTCTTTTGGOvergo seq fw:
Reverse primer:ACTTGTCATGGTGGTGTTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5469Mimulus unigene:MlU3487Phytome id:
 Arabidopsis homolog:At2g34480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAACGGTCAGATGCTTGCOvergo seq fw:
Reverse primer:TGGTACCTCAGCCAGATTCCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5470Mimulus unigene:MlU3501Phytome id:
 Arabidopsis homolog:At1g12270
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTGGAAGTCCGACAGTACCOvergo seq fw:
Reverse primer:GAACCAGGAATTGCTAGATGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5471Mimulus unigene:MlU3507Phytome id:
 Arabidopsis homolog:At1g05940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACCCATGCTTCATAGTGCOvergo seq fw:
Reverse primer:GCCGCAGCTCTTTATCTACGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5472Mimulus unigene:MlU3511Phytome id:
 Arabidopsis homolog:At4g16130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTATTCTGCAGGACACAGCOvergo seq fw:
Reverse primer:CGAAAGCCCCATCATATCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5473Mimulus unigene:MlU3516Phytome id:
 Arabidopsis homolog:At3g20290
Genetic markerPhysical marker
Map:Not MappedSet:E / F / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAACGATAGGCCAATAAACGOvergo seq fw:CCCCTTGGTTTAGAGCTTTTCGAG
Reverse primer:CCTTAAACTGTTCCACGTTCGOvergo seq rv: GGTCATCCTGTTCTCTCTCGAAAA
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5474Mimulus unigene:MlU3524Phytome id:
 Arabidopsis homolog:At4g19610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGGAGTCTGTGAACTGAGCOvergo seq fw:
Reverse primer:TTTTGAGGCAACAGAAAAGGOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5475Mimulus unigene:MlU3525Phytome id:
 Arabidopsis homolog:At1g63050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATTTTCTAGTGCCGATGCOvergo seq fw:
Reverse primer:CCGCAGCATAAGCAGTATCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5476Mimulus unigene:MlU3534Phytome id:
 Arabidopsis homolog:At5g61970
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCAGAACAATTGGATTACGCOvergo seq fw:
Reverse primer:GCATGCAACTGGGATTATGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5477Mimulus unigene:MlU3537Phytome id:
 Arabidopsis homolog:At4g34030
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGAAGCCGCAAGACAGAGGOvergo seq fw:
Reverse primer:TTCGGAGCTGGAAACTATGCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5478Mimulus unigene:MlU3541Phytome id:
 Arabidopsis homolog:At5g54810
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCACTACAAACACCCTGATGGOvergo seq fw:AAATTTGGAGGGAAGTACGTCCCC
Reverse primer:CTGCATGGAATTCCCTTACCOvergo seq rv: CGTGCATTAGGGTTTCGGGGACGT
Tm:60.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5479Mimulus unigene:MlU3542Phytome id:
 Arabidopsis homolog:At4g27070
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGAGTTGGGCATAACTTTTCGOvergo seq fw:
Reverse primer:GTAGAGGCTGCAGGTTTTGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5480Mimulus unigene:MlU3545Phytome id:
 Arabidopsis homolog:At5g26820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGGAGCATCATTATTTGGOvergo seq fw:
Reverse primer:CAGGACTCCAGCAGAGAGCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5481Mimulus unigene:MlU3554Phytome id:
 Arabidopsis homolog:At1g67070
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 7.00cM

Set:E / F / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGGCAACTTCAGACAACGOvergo seq fw:CGGTGGCTGAAGGTGATGTGTTAT
Reverse primer:CAAAAACCTGCTGTTCACTCCOvergo seq rv: GAATTTGCAGGTGCGAATAACACA
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):