Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1100 - 1199) out of 1979 markers

MlSTS5282Mimulus unigene:MlU2202Phytome id:
 Arabidopsis homolog:At5g15530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCAATACTGACTGGCTTGCOvergo seq fw:
Reverse primer:AGTCCCTTCACCGTCTTCGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5283Mimulus unigene:MlU2203Phytome id:
 Arabidopsis homolog:At5g53090
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTAATGAAAGCGCACACTGGOvergo seq fw:
Reverse primer:GCATAGCTTAGGATTTGTTGATCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5284Mimulus unigene:MlU2225Phytome id:
 Arabidopsis homolog:At5g01530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTTATGGAGAACGGAAGCOvergo seq fw:
Reverse primer:CGTCAAATCCACTCCTTTCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5285Mimulus unigene:MlU2229Phytome id:
 Arabidopsis homolog:At3g19450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCGACGACGAATCTGTACCOvergo seq fw:
Reverse primer:TCATATGGGGGTGAAAATCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5286Mimulus unigene:MlU2230Phytome id:
 Arabidopsis homolog:At3g20630
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGAGAACCCAGTCAACAGCOvergo seq fw:
Reverse primer:TCGGATTGATGACAGTTTGGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5287Mimulus unigene:MlU2232Phytome id:
 Arabidopsis homolog:At5g15400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTGTGCACCTGGTTGGOvergo seq fw:
Reverse primer:AGGGTCCAAGAACTCATCAGGOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5288Mimulus unigene:MlU2241Phytome id:
 Arabidopsis homolog:At1g59650
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)2+4 75.80cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATATTTCAGGGCGAAACGOvergo seq fw:
Reverse primer:TGTCTCGAATCCCTTTCTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5289Mimulus unigene:MlU2246Phytome id:
 Arabidopsis homolog:At3g48460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACGAGCTCATCGAAAGAGGOvergo seq fw:
Reverse primer:GTCTCCCCGTATGCATGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5290Mimulus unigene:MlU2249Phytome id:
 Arabidopsis homolog:At5g15050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGGCAAGTACGAAAAAGCOvergo seq fw:
Reverse primer:CGAAGCTCAAGCCCATCCOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5291Mimulus unigene:MlU2262Phytome id:
 Arabidopsis homolog:At1g28110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACAAGCGAACCAAGAATGCOvergo seq fw:
Reverse primer:GGATTTCTCACACCAATCTGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5292Mimulus unigene:MlU2270Phytome id:
 Arabidopsis homolog:At5g55230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTGATCCGTTTTGATGAGCOvergo seq fw:
Reverse primer:TCTGAAGAGGGCAGAAAAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5293Mimulus unigene:MlU2271Phytome id:
 Arabidopsis homolog:At3g03790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCTGGATGCTGAAGTTCCOvergo seq fw:
Reverse primer:TGAACTCAACGGGATTTTCCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5294Mimulus unigene:MlU2274Phytome id:
 Arabidopsis homolog:At1g13950
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTCATCTCGTTGGTCTGGOvergo seq fw:
Reverse primer:GATCGCTTTTGTGCTTATCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5295Mimulus unigene:MlU2275Phytome id:
 Arabidopsis homolog:At3g15020
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAATCGAACTTTGCAACTCGOvergo seq fw:
Reverse primer:GGAAGTCGTTGAAGCAAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5296Mimulus unigene:MlU2277Phytome id:
 Arabidopsis homolog:At3g53990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTACCCATAACCAAAGAATCCOvergo seq fw:
Reverse primer:TTCTCCAAAAGCAGCAAAGCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5297Mimulus unigene:MlU2281Phytome id:
 Arabidopsis homolog:At5g62530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCATGAACAACATCGATTGCOvergo seq fw:
Reverse primer:CCTTGGTTATGGAACAAATGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5298Mimulus unigene:MlU2285Phytome id:
 Arabidopsis homolog:At2g40316
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCACAGATCCCAACAGTCTCCOvergo seq fw:
Reverse primer:GTCAGCCTTCAAGCACATCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5299Mimulus unigene:MlU2287Phytome id:
 Arabidopsis homolog:At2g39960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGAGCATAGGTGAATAGTATGGOvergo seq fw:
Reverse primer:TGCTCGATGAGACAGTCACCOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5300Mimulus unigene:MlU2289Phytome id:
 Arabidopsis homolog:At3g13050
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTACTGCAGCCATTTGTTGGOvergo seq fw:CCGATTATACACATGCGGGCCCCG
Reverse primer:GCAGTGGGCAAAGTAAATGCOvergo seq rv: CCACATCTCTATTATTCGGGGCCC
Tm:59.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5301Mimulus unigene:MlU2292Phytome id:
 Arabidopsis homolog:At5g08690
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGGGCCACTACAACACTGCOvergo seq fw:CCCTGGCAAGTATGTTGAGCTGAA
Reverse primer:CCTTGGCAATAACCTCTTCGOvergo seq rv: GCTGACAATACTCTCCTTCAGCTC
Tm:60.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5302Mimulus unigene:MlU2294Phytome id:
 Arabidopsis homolog:At5g24740
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATAGCACTCCTGGCAGACCOvergo seq fw:
Reverse primer:CGACCAGACTGCGATAATGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5303Mimulus unigene:MlU2299Phytome id:
 Arabidopsis homolog:At5g46290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCGACAACAGAGTTGTGACCOvergo seq fw:
Reverse primer:CCCATCAGAGATCAAAATAAACGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5304Mimulus unigene:MlU2300Phytome id:
 Arabidopsis homolog:At5g35360
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAATTGTGGTTGGAACACCOvergo seq fw:
Reverse primer:CGTTTGTGCGAATGGATAGCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5305Mimulus unigene:MlU2310Phytome id:
 Arabidopsis homolog:At5g02960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGGGTCTCTCCTTCTTTCCOvergo seq fw:
Reverse primer:TACAAGGCCAATCCTTTTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5306Mimulus unigene:MlU2314Phytome id:
 Arabidopsis homolog:At5g67500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAATTTGGGAGTCTTATCCOvergo seq fw:
Reverse primer:ATTTCTCCGTCACCCTTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5307Mimulus unigene:MlU2317Phytome id:
 Arabidopsis homolog:At5g17310
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGGATTGGCAGGATTAGCCOvergo seq fw:CCCTGCGGCAGTCTCAAGTTGAAG
Reverse primer:AAGGAGATGCACTGAAGATGGOvergo seq rv: TGATGGGATCAAAGTTCTTCAACT
Tm:60.4Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5308Mimulus unigene:MlU2324Phytome id:
 Arabidopsis homolog:At5g63970
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATCATCGACCTTGTAATGGOvergo seq fw:ACCCTGCATACATAGCCGACAACT
Reverse primer:TTGTCGAATGCTCTTTGAGGOvergo seq rv: TCGTCCAAAGAGCTGAAGTTGTCG
Tm:60.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5309Mimulus unigene:MlU2344Phytome id:
 Arabidopsis homolog:At5g20170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTACATGAGCCACCAGTCGOvergo seq fw:
Reverse primer:TGTCAGCTTGGTTTCTCACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5310Mimulus unigene:MlU2362Phytome id:
 Arabidopsis homolog:At2g40800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGGATTTATGGTGAATCTTGCOvergo seq fw:
Reverse primer:GCTCTTTCATCTGCCATCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5311Mimulus unigene:MlU2378Phytome id:
 Arabidopsis homolog:At3g01120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTTGATTTCCGCAGTTCGOvergo seq fw:
Reverse primer:GAGCAGCAAGTCTCCATCGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5312Mimulus unigene:MlU2380Phytome id:
 Arabidopsis homolog:At2g26080
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACGGAGTTTACGAGGAAGGOvergo seq fw:
Reverse primer:GGCAAAATGAGAGCAGATCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5313Mimulus unigene:MlU2400Phytome id:
 Arabidopsis homolog:At4g14965
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGATAGCCTTCGTCACACCOvergo seq fw:
Reverse primer:TGAAAAGCATCGTTGAATGGOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5314Mimulus unigene:MlU2408Phytome id:
 Arabidopsis homolog:At5g14700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATCACATGCCAGCTTCTCGOvergo seq fw:
Reverse primer:TTGGTATGCTCTGGGAAAGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5315Mimulus unigene:MlU2409Phytome id:
 Arabidopsis homolog:At1g78060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTGAAGTTTCATCGGTTGGOvergo seq fw:
Reverse primer:GGTTCTTGTGTTGGTTTGTGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5316Mimulus unigene:MlU2417Phytome id:
 Arabidopsis homolog:At3g06530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTTCGCTACGAGTTTGCOvergo seq fw:
Reverse primer:GAAGAAGAAGAAGGCGAAGCOvergo seq rv:
Tm:58.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5317Mimulus unigene:MlU2433Phytome id:
 Arabidopsis homolog:At3g53580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTCCACAGGCTAATGTTGCOvergo seq fw:
Reverse primer:TCCTCACTGCATCACTTTCGOvergo seq rv:
Tm:58.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5318Mimulus unigene:MlU2434Phytome id:
 Arabidopsis homolog:At3g42050
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATTTTCTGCCACACTCTCGOvergo seq fw:CGAGGATCAGTCGATGTGTCCAAA
Reverse primer:CAAATCCCAAAAGAGCAAGGOvergo seq rv: GGGTCCTGATTACGATTTTGGACA
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5319Mimulus unigene:MlU2440Phytome id:
 Arabidopsis homolog:At3g06060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCTGGAGGGAAGATGAGGOvergo seq fw:
Reverse primer:ACGTCCTCGTGTGCAACCOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5320Mimulus unigene:MlU2441Phytome id:
 Arabidopsis homolog:At3g11830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCACAGATTCCTCTCAAGGOvergo seq fw:
Reverse primer:CATCTTCAATGAATGGTTTTGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5321Mimulus unigene:MlU2466Phytome id:
 Arabidopsis homolog:At3g52820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGGTTTGTCCTAGGTCTCCOvergo seq fw:
Reverse primer:GGAGAGAGCACTTCGTACCGOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5322Mimulus unigene:MlU2469Phytome id:
 Arabidopsis homolog:At4g37640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCAGCGCTCTCTTTAGCCOvergo seq fw:
Reverse primer:AGTCCGTTGCACTTTGTCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5323Mimulus unigene:MlU2496Phytome id:
 Arabidopsis homolog:At1g74050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCTGGTCGTCTTTCTTCTCGOvergo seq fw:
Reverse primer:GCAGCTTTCTTCTGGATTGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5324Mimulus unigene:MlU2543Phytome id:
 Arabidopsis homolog:At3g07700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCTTTCACCCTTTGCATGGOvergo seq fw:
Reverse primer:CACGATCTCCATGCCTTACCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5325Mimulus unigene:MlU2549Phytome id:
 Arabidopsis homolog:At1g80460
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAATGCCATTGTTTGGATGGOvergo seq fw:CCGTCGGATCTCACCAAGTTGAAT
Reverse primer:CGGAGTTGCTGACTATTTTGGOvergo seq rv: GGATAGAACTGGGTGAATTCAACT
Tm:59.2Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5326Mimulus unigene:MlU2551Phytome id:
 Arabidopsis homolog:At4g31990
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTCAAGGCTCCCACTAGCOvergo seq fw:AAGTATCTCTCTATCAACGCTGCA
Reverse primer:GTCGGTTTGGATTTTGATGGOvergo seq rv: GGTCTCTGCGACTTGCTGCAGCGT
Tm:60.4Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5327Mimulus unigene:MlU2563Phytome id:
 Arabidopsis homolog:At1g01470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTGGGGAATTTCATCTCACCOvergo seq fw:
Reverse primer:CGAGCAAGCAAAGAACTACGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5328Mimulus unigene:MlU2572Phytome id:
 Arabidopsis homolog:At4g19640
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTGCCACCTTTCTTCCATCCOvergo seq fw:ATCTGCTGGTCGATCCACAAGCAC
Reverse primer:GGGATACGGCAGGTCAGGOvergo seq rv: AAACCCATCAGGTATGGTGCTTGT
Tm:61.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5329Mimulus unigene:MlU2573Phytome id:
 Arabidopsis homolog:At1g74470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTGCAGGATGTCCAGAACCOvergo seq fw:
Reverse primer:GTGTCACCCGATTTCTACGGOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5330Mimulus unigene:MlU2580Phytome id:
 Arabidopsis homolog:At2g17790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGAACAAGCTGAGGTTCCOvergo seq fw:
Reverse primer:TGGGAACAAGTAGCAACACCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5331Mimulus unigene:MlU2582Phytome id:
 Arabidopsis homolog:At4g21110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAAAAGTCTCCCCCAGAAGGOvergo seq fw:
Reverse primer:CGTAAGCAATATTCATAGAGTTCTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5332Mimulus unigene:MlU2584Phytome id:
 Arabidopsis homolog:At5g58050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGTCAACGCAGAAAGTCCOvergo seq fw:
Reverse primer:GTATGCCGATCCTTTTGTCGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5333Mimulus unigene:MlU2590Phytome id:
 Arabidopsis homolog:At3g52990
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGCAAGGGGAAAAGACCOvergo seq fw:
Reverse primer:CCCATGTCTCACTTGGAAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5334Mimulus unigene:MlU2597Phytome id:
 Arabidopsis homolog:At1g62660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGAGTTACTTCCGACAACGOvergo seq fw:
Reverse primer:AGCAGAGGAGGATCTTGTGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5335Mimulus unigene:MlU2601Phytome id:
 Arabidopsis homolog:At3g54470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTTGCTGCCTTTATGATCCOvergo seq fw:
Reverse primer:TTCAGGTCCTGGAATTGTGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5336Mimulus unigene:MlU2604Phytome id:
 Arabidopsis homolog:At1g08510
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)5+8 44.20cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACTCGATGACACCACTGCOvergo seq fw:GGCGGTGAAATTGTCAAAGGAAGA
Reverse primer:GCCTCCATTTGGTTCTTCCOvergo seq rv: TGGGCCTCCATTTGGTTCTTCCTT
Tm:58.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5337Mimulus unigene:MlU2611Phytome id:
 Arabidopsis homolog:At1g32400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAACAGCACCAAGAGCAACCOvergo seq fw:
Reverse primer:GGAACGTCTACACGGAATGGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5338Mimulus unigene:MlU2615Phytome id:
 Arabidopsis homolog:At5g09470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTCACCGTAAGTGATGAGCOvergo seq fw:
Reverse primer:GACATCCTCAAGACGAAGTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5339Mimulus unigene:MlU2629Phytome id:
 Arabidopsis homolog:At2g03800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCAGCTGGTGGTACATCTCCOvergo seq fw:
Reverse primer:GAGATGGTCACGTTAGTTGTCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5340Mimulus unigene:MlU2636Phytome id:
 Arabidopsis homolog:At1g23800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAAATATGGCGGTAACAAGCOvergo seq fw:
Reverse primer:TTCACGAAGTGCGTATTTTCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5341Mimulus unigene:MlU2647Phytome id:
 Arabidopsis homolog:At2g36530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTTGTATTTTGCCAGACGOvergo seq fw:
Reverse primer:GACCAAGATGATTGGGAAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5342Mimulus unigene:MlU2649Phytome id:
 Arabidopsis homolog:At3g20050
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATCATGCAATGCCCTGTCCOvergo seq fw:
Reverse primer:GGTGCAATAGCTGTGAGACGOvergo seq rv:
Tm:61.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5343Mimulus unigene:MlU2660Phytome id:
 Arabidopsis homolog:At3g18060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATTGATTGGTTTGCTGTGGOvergo seq fw:
Reverse primer:TCCGGTAATGTGATTGTTGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5344Mimulus unigene:MlU2662Phytome id:
 Arabidopsis homolog:At3g15660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACATCGAGGAAGCTCAGGOvergo seq fw:
Reverse primer:ATTGTGGGATGTCCATCTGCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5345Mimulus unigene:MlU2665Phytome id:
 Arabidopsis homolog:At1g29880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTTGCTGTCTCTTTCTCGOvergo seq fw:
Reverse primer:AATATGGTGTCGATCTCCAAGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5346Mimulus unigene:MlU2673Phytome id:
 Arabidopsis homolog:At3g57660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTCCCGATGCTTTTACTGCOvergo seq fw:
Reverse primer:GGAAGATGAAACGAGAACAGCOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5347Mimulus unigene:MlU2678Phytome id:
 Arabidopsis homolog:At3g28715
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTACTTGGAAGGCTTGGOvergo seq fw:
Reverse primer:GGGTTCTAGGGAATGGTTGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5348Mimulus unigene:MlU2704Phytome id:
 Arabidopsis homolog:At5g22790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGCCTTGCCCAATAAGACCOvergo seq fw:
Reverse primer:GCGGAGTTCGAGTTGTATGCOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5349Mimulus unigene:MlU2707Phytome id:
 Arabidopsis homolog:At1g26910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAATCTTGCCCTCTGATTTCCOvergo seq fw:
Reverse primer:CTTGGTCAGTTGGGAGAAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5350Mimulus unigene:MlU2717Phytome id:
 Arabidopsis homolog:At3g44110
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGACTTTCTGACCGTGTTGCOvergo seq fw:
Reverse primer:AAGAAGGGGAGAGGATGTGGOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5351Mimulus unigene:MlU2730Phytome id:
 Arabidopsis homolog:At5g45550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAGCCGAAACTTCAATAGGOvergo seq fw:
Reverse primer:GATCTGCCCTACAATGTCTGCOvergo seq rv:
Tm:58.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5352Mimulus unigene:MlU2734Phytome id:
 Arabidopsis homolog:At5g09550
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACATTGCACCAGGTTGAGGOvergo seq fw:
Reverse primer:GAAATTTGGCATGGGAACCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5353Mimulus unigene:MlU2736Phytome id:
 Arabidopsis homolog:At1g15370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTCTCCAGCAGACCCTTCCOvergo seq fw:
Reverse primer:CAATGGAGTTCCAGCAGAGGOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5354Mimulus unigene:MlU2744Phytome id:
 Arabidopsis homolog:At4g09320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAATCACCACGGATGGTTCCOvergo seq fw:
Reverse primer:GGCAGGTTTGAAAAGAAAGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5355Mimulus unigene:MlU2765Phytome id:
 Arabidopsis homolog:At2g45300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTGGACTTCAGCAGCTTGGOvergo seq fw:
Reverse primer:GTGTGCTCGACAAAGACACCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5356Mimulus unigene:MlU2767Phytome id:
 Arabidopsis homolog:At5g58510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTCTTCGATAACATCGCTACCOvergo seq fw:
Reverse primer:CTCCTCGTGGAAGACTTTCGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5357Mimulus unigene:MlU2772Phytome id:
 Arabidopsis homolog:At4g29040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGCTCCAGAAAACTCATCCOvergo seq fw:
Reverse primer:TCTTCATTGACGAAATTGATGCOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5358Mimulus unigene:MlU2781Phytome id:
 Arabidopsis homolog:At4g15093
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACGAGCTCACCTCTGGOvergo seq fw:
Reverse primer:GTCCATGTGGACAAGAAACGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5359Mimulus unigene:MlU2800Phytome id:
 Arabidopsis homolog:At5g27120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCACAGAACCAGCAGAACGOvergo seq fw:
Reverse primer:AGCAGAATGAACACCATTGCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5360Mimulus unigene:MlU2802Phytome id:
 Arabidopsis homolog:At1g31230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCCTGGAGTTAGTGCTACGOvergo seq fw:
Reverse primer:TCCAGTAATTCCCATCACACGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5361Mimulus unigene:MlU2812Phytome id:
 Arabidopsis homolog:At1g20080
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGAATTCTTCGTTCCATTCGOvergo seq fw:CCTGGACAGTAGCTTTCAACCCAA
Reverse primer:TAGGCGCTGATGCTATGTCCOvergo seq rv: GTTGCTGCTAAGGCATTTGGGTTG
Tm:59.6Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5362Mimulus unigene:MlU2832Phytome id:
 Arabidopsis homolog:At1g79040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGTCGTTGGCTAGAACCOvergo seq fw:
Reverse primer:AAACATCACCAGTTGGAGACCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5363Mimulus unigene:MlU2834Phytome id:
 Arabidopsis homolog:At2g05920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TATGTGTGGGCAAGACATCGOvergo seq fw:
Reverse primer:AAGGAAGCAGGTGGAGTGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5364Mimulus unigene:MlU2848Phytome id:
 Arabidopsis homolog:At1g67325
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTATCGCGAGTTCCATCACCOvergo seq fw:
Reverse primer:ACCCTCCTTACGCAAATGGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5365Mimulus unigene:MlU2852Phytome id:
 Arabidopsis homolog:At5g23810
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAAGTCCCGTTGTAGATGCOvergo seq fw:
Reverse primer:TTTTGGCTTGTTGACATTGCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5366Mimulus unigene:MlU2864Phytome id:
 Arabidopsis homolog:At2g20340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACCAGCCACAATTTCAGCOvergo seq fw:
Reverse primer:CCTTAACGGAGTCGAGAACGOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5367Mimulus unigene:MlU2866Phytome id:
 Arabidopsis homolog:At4g16160
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)5+8 81.50cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCTCTCGCCTCTTTCAACCOvergo seq fw:
Reverse primer:CAAGAAGCGTCATCAGTTTCCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5368Mimulus unigene:MlU2869Phytome id:
 Arabidopsis homolog:At5g09650
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGATCTTTTCACAAGCTTAGCCOvergo seq fw:GCCTGCACGAATAGATCTTTTCAC
Reverse primer:ATTGACGAAGGGGAACTCGOvergo seq rv: GTCGTGGGCTAAGCTTGTGAAAAG
Tm:57.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5369Mimulus unigene:MlU2875Phytome id:
 Arabidopsis homolog:At2g28490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCAGAATTCAAAGCATGTGGOvergo seq fw:
Reverse primer:GATATGTTCCACCAGCAACGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5370Mimulus unigene:MlU2884Phytome id:
 Arabidopsis homolog:At1g71790
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCATCAGATCGATTGAGAAAGCOvergo seq fw:
Reverse primer:GATCTTCTTTGAGCCATCACCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5371Mimulus unigene:MlU2886Phytome id:
 Arabidopsis homolog:At3g60750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACTCGGAAAGTTGATTGCOvergo seq fw:
Reverse primer:CCATCCGAGGTTCTCTCTGGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5372Mimulus unigene:MlU2889Phytome id:
 Arabidopsis homolog:At1g48130
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAAGAGAATCCACCACACGOvergo seq fw:
Reverse primer:CTGAACTGACTCAGGCTTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5373Mimulus unigene:MlU2895Phytome id:
 Arabidopsis homolog:At2g41620
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCTCAGTGCGTCTAAATGGOvergo seq fw:
Reverse primer:TGATGGCAAGACAAGACAGCOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5374Mimulus unigene:MlU2919Phytome id:
 Arabidopsis homolog:At1g17370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCTGATCATCGCCTAGACCOvergo seq fw:
Reverse primer:CGCTTGCTTCTCTGTCTATCCOvergo seq rv:
Tm:61.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5375Mimulus unigene:MlU2920Phytome id:
 Arabidopsis homolog:At2g28470
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTATCTCAGCCTGCTCTTCCOvergo seq fw:GCACTGGTGCAAACTGTTGGTATT
Reverse primer:AAGACATCATCGTCGGATCGOvergo seq rv: GGCCTTGACTAACAGTAATACCAA
Tm:60.4Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5376Mimulus unigene:MlU2933Phytome id:
 Arabidopsis homolog:At5g51070
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTACGGCAATATCACCATGCOvergo seq fw:
Reverse primer:GATGTTTCGACCTCGTATGCOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5377Mimulus unigene:MlU2936Phytome id:
 Arabidopsis homolog:At1g70160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCAAAATCTGGCAAAAGGOvergo seq fw:
Reverse primer:GCAAACATGTGGAATGAAGCOvergo seq rv:
Tm:60.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5378Mimulus unigene:MlU2943Phytome id:
 Arabidopsis homolog:At1g80460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGTTCTAGAGACCGCCTTGCOvergo seq fw:
Reverse primer:TTGGGATCACGAGGTTTACGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5379Mimulus unigene:MlU2946Phytome id:
 Arabidopsis homolog:At3g62120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTCAATTTGGGAGGTCATGCOvergo seq fw:
Reverse primer:TGATAAATGGAGTGGGATTGCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5380Mimulus unigene:MlU2947Phytome id:
 Arabidopsis homolog:At3g62120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAAGCGAAGCACAACGTACCOvergo seq fw:
Reverse primer:GTGCGACGTGATAATTCAGCOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5381Mimulus unigene:MlU2952Phytome id:
 Arabidopsis homolog:At3g19960
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCAACAACTTCCAATCTCCOvergo seq fw:GTAGGTGCACTGCACAAATCTGGT
Reverse primer:ACTTTGCACACGCAGAATACCOvergo seq rv: TCTGTGAATCTGCTCCACCAGATT
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):