Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (1000 - 1099) out of 1979 markers

MlSTS5176Mimulus unigene:MlU1236Phytome id:
 Arabidopsis homolog:At5g23060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCAGTGCCACCAACTCAGCOvergo seq fw:
Reverse primer:GGTGGTGCCTTAGTCATTGCOvergo seq rv:
Tm:61.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5177Mimulus unigene:MlU1250Phytome id:
 Arabidopsis homolog:At4g31490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGTTGGCTGCCATAAAACCOvergo seq fw:
Reverse primer:ACTGGTTGAGAAGCCACAGCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5178Mimulus unigene:MlU1272Phytome id:
 Arabidopsis homolog:At4g27720
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)2+4 26.80cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACATTCAAAGGCTCATCCOvergo seq fw:GCTCATCCTCGGCATTTTTATCCT
Reverse primer:TGGATTCTGCACTTTTGAGGOvergo seq rv: GATTGGGCTATGATGAAGGATAAA
Tm:60.5Tm:63.35
IM62 length0BAC contig(s):
    
MlSTS5179Mimulus unigene:MlU1278Phytome id:
 Arabidopsis homolog:At5g40760
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGACATAACCTGCTCGTTCCOvergo seq fw:CAGGGCCTCTGCTTCCAGGTTTGT
Reverse primer:TACCAAGGGGTTGTCATTCCOvergo seq rv: TTTAAGTCTCTACCGTACAAACCT
Tm:59.6Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5180Mimulus unigene:MlU1286Phytome id:
 Arabidopsis homolog:At5g01960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACAGCATGCACTTGAAGACCOvergo seq fw:
Reverse primer:TGCTGCTTTCATGTTTAAGTCGOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5181Mimulus unigene:MlU1315Phytome id:
 Arabidopsis homolog:At3g51460
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCTTGGATTGTCCTCTGGOvergo seq fw:
Reverse primer:TGGACCGTACAAATGTCACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5182Mimulus unigene:MlU1321Phytome id:
 Arabidopsis homolog:At4g15180
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGAGGTCTGTGCTTTAACCOvergo seq fw:
Reverse primer:TTTTGGCACGATCAAAATGCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5183Mimulus unigene:MlU1326Phytome id:
 Arabidopsis homolog:At5g01300
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTTGATCCCTGCGTACTCGOvergo seq fw:
Reverse primer:CGTCGTCGAACATAAGTCAGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5184Mimulus unigene:MlU1341Phytome id:
 Arabidopsis homolog:At4g37510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTTGTTGAACTGATGTGGOvergo seq fw:
Reverse primer:CGAGCTTGGACTAGGATTGCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5185Mimulus unigene:MlU1342Phytome id:
 Arabidopsis homolog:At3g04120
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCGATGAAGGACTGGAGAGGOvergo seq fw:
Reverse primer:CGGATCAAGTCAATCACACGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5186Mimulus unigene:MlU1343Phytome id:
 Arabidopsis homolog:At1g02780
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AACTTCCTTTCGCGACTAGCOvergo seq fw:
Reverse primer:GGAGGTTGGTGAAGGATGGOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5187Mimulus unigene:MlU1345Phytome id:
 Arabidopsis homolog:At2g26910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTCATCATGCCGTAAAAGGOvergo seq fw:
Reverse primer:TCTGTTGGGAATTTGGTTCCOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5188Mimulus unigene:MlU1354Phytome id:
 Arabidopsis homolog:At2g33740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAGCCGCTCTTTGACTATGCOvergo seq fw:
Reverse primer:ACGGTTCCAAACAAGGAAGCOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5189Mimulus unigene:MlU1361Phytome id:
 Arabidopsis homolog:At1g56700
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGAAATCGCACCATCTGCOvergo seq fw:
Reverse primer:GAGTTGCTGAAAATCCTACGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5190Mimulus unigene:MlU1376Phytome id:
 Arabidopsis homolog:At3g55380
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACGAGAAGGCTTCCGAACGOvergo seq fw:
Reverse primer:CATTAGCTGGGGATTCATCGOvergo seq rv:
Tm:62.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5191Mimulus unigene:MlU1383Phytome id:
 Arabidopsis homolog:At1g31500
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACTCGACAATGGAATCATCGOvergo seq fw:
Reverse primer:CGTGACTGTGTAGGAACAATGGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5192Mimulus unigene:MlU1384Phytome id:
 Arabidopsis homolog:At5g64040
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGTACTTGTCCTTGCCTTCGOvergo seq fw:GCACTTGTACTTGTCCTTGCCTTC
Reverse primer:TGCCTTCTGTTGCAACTCCOvergo seq rv: TTTGGCTTTGGAGTGCGAAGGCAA
Tm:58.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5193Mimulus unigene:MlU1400Phytome id:
 Arabidopsis homolog:At4g38220
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTGGTGTGTTTGCCATAGGOvergo seq fw:
Reverse primer:TTTTGTCATGAATTTGCAACCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5194Mimulus unigene:MlU1410Phytome id:
 Arabidopsis homolog:At3g25920
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCACCGGGACATACTTTGGOvergo seq fw:
Reverse primer:GGAAGAAGGCGAAGAGAAAGGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5195Mimulus unigene:MlU1417Phytome id:
 Arabidopsis homolog:At5g16070
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATCCGAAAGCCGAAGTAGCOvergo seq fw:
Reverse primer:GCCCGAGCAATTAAAGAAGCOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5196Mimulus unigene:MlU1423Phytome id:
 Arabidopsis homolog:At3g15000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTGTCGTTTCTCCTGTTCCOvergo seq fw:
Reverse primer:GGAGTTCGTTGGGTTCTTCCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5197Mimulus unigene:MlU1427Phytome id:
 Arabidopsis homolog:At1g12840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCCATACTCAGCAACACGOvergo seq fw:
Reverse primer:GTGTCGCACAAAATCAGACGOvergo seq rv:
Tm:60.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5198Mimulus unigene:MlU1435Phytome id:
 Arabidopsis homolog:At5g08470
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGGAAACTGATGGTTTAGCCOvergo seq fw:GTTGCCCTTTTGCCTTTTGCATCT
Reverse primer:TTTGTGATTTCCCATCTCAGCOvergo seq rv: TTGCTGCTCAGACGAGAGATGCAA
Tm:59.6Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5199Mimulus unigene:MlU1442Phytome id:
 Arabidopsis homolog:At1g01540
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCCGACTATAATCGACAGGOvergo seq fw:
Reverse primer:CTTTGACGTGGGAAATACGGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5200Mimulus unigene:MlU1461Phytome id:
 Arabidopsis homolog:At4g16720
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCGTCTAACACGAACACGOvergo seq fw:
Reverse primer:CATACGTGTCGGAGCTATGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5201Mimulus unigene:MlU1463Phytome id:
 Arabidopsis homolog:At4g21190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGAATCACTACTATCCTCTGTTGCOvergo seq fw:
Reverse primer:TGCTTTGCTGAATGCTTTGGOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5202Mimulus unigene:MlU1471Phytome id:
 Arabidopsis homolog:At3g13300
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCGAATATTGGAAAGTTCAGCOvergo seq fw:AGCCTCCTCGTATTTTCGCTCAGC
Reverse primer:GGGTGCTCTACACGAGAAGGOvergo seq rv: GCTATCTAGGCTGATAGCTGAGCG
Tm:58.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5203Mimulus unigene:MlU1472Phytome id:
 Arabidopsis homolog:At5g39040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGACTCCGACATAGAAAACGOvergo seq fw:
Reverse primer:AGTCCTGCCTTTCATTAGGGOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5204Mimulus unigene:MlU1478Phytome id:
 Arabidopsis homolog:At3g27240
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCCGTTGCAGGAACACCOvergo seq fw:GCGCCGATAGTAACCAGCTTGAAG
Reverse primer:TATGGCAGCTGAGATTGAGGOvergo seq rv: TCTATCACTGGCACTTCTTCAAGC
Tm:60.7Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5205Mimulus unigene:MlU1484Phytome id:
 Arabidopsis homolog:At1g76400
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCTCAAGAGTTGGTACGCOvergo seq fw:AACATTATAACCTCGTTCATGCTG
Reverse primer:GAAATCTCGAAGCGACAAGCOvergo seq rv: CCTGTGAGCTCCGCACCAGCATGA
Tm:59.1Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5206Mimulus unigene:MlU1486Phytome id:
 Arabidopsis homolog:At3g03960
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGGTACTATGCGGCTGTCCOvergo seq fw:
Reverse primer:GCACAACTGGTGCTGTCGOvergo seq rv:
Tm:60.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5207Mimulus unigene:MlU1487Phytome id:
 Arabidopsis homolog:At3g27020
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGGAGCTGCTTTAAATGGOvergo seq fw:GGGTCGGCGATTCATGTGGATTTG
Reverse primer:GCCTTCAGCGTTATGAATGGOvergo seq rv: AGGCTTGGGAAATTGTCAAATCCA
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5209Mimulus unigene:MlU1507Phytome id:
 Arabidopsis homolog:At4g34215
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)2+4 32.20cM

Set:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAATTCGGGCTATCTTGTGGOvergo seq fw:AAGGAGAAATACAGGTTGGCCAAA
Reverse primer:TGGCCAACCTGTATTTCTCCOvergo seq rv: AAGGCTCCGGCCATCATTTGGCCA
Tm:57.7Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5210Mimulus unigene:MlU1516Phytome id:
 Arabidopsis homolog:At1g22450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCGAACTTGTCACACTCGOvergo seq fw:
Reverse primer:GAGAACTCAGATGCTCAAGAAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5211Mimulus unigene:MlU1526Phytome id:
 Arabidopsis homolog:At4g00100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTAGTACCTGGCCAAACGOvergo seq fw:
Reverse primer:CCAATCAGCGCTACCATACCOvergo seq rv:
Tm:58.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5212Mimulus unigene:MlU1540Phytome id:
 Arabidopsis homolog:At5g38900
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 13.40cM

Set:F / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTTTTTGGCAGCTTCTACGOvergo seq fw:TTTAAAAGTCCTTAGGAAGGTCTC
Reverse primer:CCTCGAGCGATACAGATGGOvergo seq rv: TGGAGGTCAGCCACCCGAGACCTT
Tm:60.0Tm:65.40
IM62 length0BAC contig(s):MgFPC2744, MgFPC671, MlFPC1102
    
MlSTS5213Mimulus unigene:MlU1550Phytome id:
 Arabidopsis homolog:At2g26930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TACCGCCACAATTGTACTCCOvergo seq fw:
Reverse primer:ACAGGAGCTTTGTGTCAACGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5214Mimulus unigene:MlU1556Phytome id:
 Arabidopsis homolog:At4g22240
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGTCCCTATGATGCCTTCCOvergo seq fw:CGAATATGTCAACTGCGGTGTCCC
Reverse primer:GAGTGCAAGAACCCAACTCCOvergo seq rv: TGAGGAAGGCATCATAGGGACACC
Tm:59.4Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5215Mimulus unigene:MlU1576Phytome id:
 Arabidopsis homolog:At5g27740
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGGAAACCCTTGTAGACGOvergo seq fw:
Reverse primer:CGGGGAAAGCTTTATGAGCOvergo seq rv:
Tm:57.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5216Mimulus unigene:MlU1582Phytome id:
 Arabidopsis homolog:At1g12230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGAGAAGATCCTGGGTTGGOvergo seq fw:
Reverse primer:ACACGTTTCGATTGGGTAGCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5217Mimulus unigene:MlU1584Phytome id:
 Arabidopsis homolog:At3g47470
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGGGAACGTTGATGATGCOvergo seq fw:
Reverse primer:AAGAAAGGCGAATGGCTACCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5218Mimulus unigene:MlU1590Phytome id:
 Arabidopsis homolog:At2g44900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTTGAATTGGTGAACTGGOvergo seq fw:
Reverse primer:GTGTTGACCTTTTCCGATCCOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5219Mimulus unigene:MlU1592Phytome id:
 Arabidopsis homolog:At1g26480
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAGAATCATGTCTTCCATCGOvergo seq fw:
Reverse primer:GTTCAAAGCAAGACCAAGACGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5220Mimulus unigene:MlU1606Phytome id:
 Arabidopsis homolog:At3g51290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTTGCCTAGCTTCTGATGGOvergo seq fw:
Reverse primer:TCTCTAGCTTCCTCAGCATCGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5221Mimulus unigene:MlU1611Phytome id:
 Arabidopsis homolog:At3g55830
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGATTCAAGCCAATTGAGGOvergo seq fw:CCGCTTACAATGGTGGGATTTGTT
Reverse primer:GGCTTTTGAGAGAACCATGCOvergo seq rv: GCCAATGCATACGAGGAACAAATC
Tm:58.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5223Mimulus unigene:MlU1632Phytome id:
 Arabidopsis homolog:At3g24170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTGGGCAGCCTACAAAACCOvergo seq fw:
Reverse primer:GAAACCGTGTTCTTCATTGGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5224Mimulus unigene:MlU1648Phytome id:
 Arabidopsis homolog:At1g53750
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCACACGCTTCTTATGTCCOvergo seq fw:ATACATACCAGCCTCAGTGCACAC
Reverse primer:GATTCGACGATGGTGTGGOvergo seq rv: AGCGGACATAAGAAGCGTGTGCAC
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5225Mimulus unigene:MlU1649Phytome id:
 Arabidopsis homolog:At1g73230
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCAGGCACTTGCTTCTGGOvergo seq fw:
Reverse primer:GAGAATAGGAGTGAATGCCATACCOvergo seq rv:
Tm:61.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5226Mimulus unigene:MlU1661Phytome id:
 Arabidopsis homolog:At3g19090
Genetic markerPhysical marker
Map:Not MappedSet:E
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCGAAGATGAGCGAAGAGCOvergo seq fw:ATTGGAAACACGGGTAGAAGTATC
Reverse primer:CCCAAGGAGATTTCCCTACCOvergo seq rv: CAGGTGCCCATAACGGGATACTTC
Tm:60.8Tm:65.4
IM62 length0BAC contig(s):
    
MlSTS5227Mimulus unigene:MlU1671Phytome id:
 Arabidopsis homolog:At5g43060
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCGTACTCGTAAACACAGCOvergo seq fw:
Reverse primer:TTGCAAATCAACCCGTTAGCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5228Mimulus unigene:MlU1674Phytome id:
 Arabidopsis homolog:At2g21160
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGTCCCAGTTCCAACTTCCOvergo seq fw:
Reverse primer:GCTTTTAACAATGCATCAGTTCCOvergo seq rv:
Tm:59.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5229Mimulus unigene:MlU1677Phytome id:
 Arabidopsis homolog:At5g51830
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CTTCGTCTTTCGTAGGTAGGGOvergo seq fw:
Reverse primer:ATTTCGTTTTTGACCCAAGGOvergo seq rv:
Tm:58.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5230Mimulus unigene:MlU1698Phytome id:
 Arabidopsis homolog:At1g12900
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTCGACCTGGACCACTAGGOvergo seq fw:
Reverse primer:AGCAGGGAAGCATATTCAGGOvergo seq rv:
Tm:60.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5231Mimulus unigene:MlU1708Phytome id:
 Arabidopsis homolog:At5g64610
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TAGCCAACCATGTGACATCCOvergo seq fw:
Reverse primer:CGCAAAGAACAACTTCAGAGGOvergo seq rv:
Tm:59.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5232Mimulus unigene:MlU1710Phytome id:
 Arabidopsis homolog:At1g56340
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGGTCTGATTTGACATCATCGOvergo seq fw:
Reverse primer:TGAAATCTGGAACCTTGTTCGOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5233Mimulus unigene:MlU1713Phytome id:
 Arabidopsis homolog:At5g10290
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)6 0.00cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCCAATCAAATCTCCTCTGCOvergo seq fw:CGGCAACAACTGTGTGCACAAAAG
Reverse primer:CATTGCTCCCGAGTATTTATCCOvergo seq rv: GATGATACAGGTGGCACTTTTGTG
Tm:59.6Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5234Mimulus unigene:MlU1721Phytome id:
 Arabidopsis homolog:At5g25510
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGGAGGAGATATTGGAAGCOvergo seq fw:GGTGATGTTTTTGGGTGAGGTGGA
Reverse primer:CAATTGGCTGGAGATTAGCCOvergo seq rv: GGCTTCCAATATCTCCTCCACCTC
Tm:59.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5235Mimulus unigene:MlU1725Phytome id:
 Arabidopsis homolog:At4g34450
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CACATCCCATGGCTGTAACCOvergo seq fw:CTGCACTTGTACAGTTCCATGCAC
Reverse primer:TCACACAAGTGCACCAATCCOvergo seq rv: TGGTGAAGCAGAGCAAGTGCATGG
Tm:61.2Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5236Mimulus unigene:MlU1727Phytome id:
 Arabidopsis homolog:At5g53480
Genetic markerPhysical marker
Map:Not MappedSet:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGTCGCAGTTTCTTTCAGCOvergo seq fw:TTTATGTTTGCACCAAGCGCATCC
Reverse primer:TCCTGCTTTGGAGACATTGCOvergo seq rv: TTCTCGGTGATGCAGCGGATGCGC
Tm:60.6Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5238Mimulus unigene:MlU1750Phytome id:
 Arabidopsis homolog:At3g10330
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)5+8 0.00cM

Set:E / F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCCTTTGCAAACCATTCTGGOvergo seq fw:GCATTCTTGATTGTCCCTTCTGCC
Reverse primer:AGGTTGAGATGGGTGAATCGOvergo seq rv: CGATTGCTACGACAGTGGCAGAAG
Tm:61.0Tm:65.40
IM62 length0BAC contig(s):MgFPC3005, MgFPC649, MgFPC981, MlFPC1, MlFPC109, MlFPC1552, MlFPC189, MlFPC527
    
MlSTS5239Mimulus unigene:MlU1755Phytome id:
 Arabidopsis homolog:At5g63530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)7 15.00cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTTTGGGTTTCTCCTCTTCCOvergo seq fw:
Reverse primer:ATGCATTGTGAAGCTTGTGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5240Mimulus unigene:MlU1757Phytome id:
 Arabidopsis homolog:At4g00400
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTGAACCTCAGCAGATACGOvergo seq fw:
Reverse primer:GCTCTCGAGATTCCTCTCTCCOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5241Mimulus unigene:MlU1762Phytome id:
 Arabidopsis homolog:At3g12010
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATCTCAGAGACGATACGATGGOvergo seq fw:
Reverse primer:TTGAGCCTTCAAAAGAAGTAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5242Mimulus unigene:MlU1763Phytome id:
 Arabidopsis homolog:At1g47128
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGGATAGTGAGGAACTCATGGOvergo seq fw:
Reverse primer:ATCGGTTTCGCAAGAATACGOvergo seq rv:
Tm:59.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5243Mimulus unigene:MlU1775Phytome id:
 Arabidopsis homolog:At1g61580
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGATATCCTCCAACGCAACCOvergo seq fw:CCCATAGTGAGGGAACCCTCCCAT
Reverse primer:TGGAGTGACCAAGGGTAAGGOvergo seq rv: GAAGGATATAACACCAATGGGAGG
Tm:60.9Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5244Mimulus unigene:MlU1777Phytome id:
 Arabidopsis homolog:At2g30490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCATGTGGGGGACTAAGAGCOvergo seq fw:
Reverse primer:TCTTGAAGCCCAACAAAAGGOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5245Mimulus unigene:MlU1779Phytome id:
 Arabidopsis homolog:At5g33370
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)2+4 0.00cM

Set:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGTGCTGATGTCTTTGTTGCOvergo seq fw:CCGGACTACGTTCGATTCCTCATT
Reverse primer:GGTCCTTGTCCACAACATGCOvergo seq rv: CTTTGCGATACTCAGAAATGAGGA
Tm:59.3Tm:64.38
IM62 length0BAC contig(s):
    
MlSTS5246Mimulus unigene:MlU1789Phytome id:
 Arabidopsis homolog:At3g15730
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCTCACCTCTAGCTGGTTGCOvergo seq fw:
Reverse primer:ATGTTGTGGTGCCTATGTGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5247Mimulus unigene:MlU1798Phytome id:
 Arabidopsis homolog:At4g39520
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAGAAGACCGTCGAGATTCCOvergo seq fw:
Reverse primer:AAAGAGCTCGAGGGATTTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5248Mimulus unigene:MlU1813Phytome id:
 Arabidopsis homolog:At5g62410
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCCTTACAGGGGGTTCTCGOvergo seq fw:
Reverse primer:TGTGATGTCTGTTCAAGTCTGGOvergo seq rv:
Tm:62.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5249Mimulus unigene:MlU1819Phytome id:
 Arabidopsis homolog:At5g22860
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGCATATCTTGGTGCAGAGGOvergo seq fw:
Reverse primer:TGGATACTTGAGCCGAAACCOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5250Mimulus unigene:MlU1824Phytome id:
 Arabidopsis homolog:At5g38660
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGAGACGCCAAGACTTAATCCOvergo seq fw:
Reverse primer:CCTAACTCTAGCGGAAACTTCGOvergo seq rv:
Tm:59.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5251Mimulus unigene:MlU1828Phytome id:
 Arabidopsis homolog:At1g72370
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATGGGAGAAGCTTCAGATGGOvergo seq fw:
Reverse primer:CATGATTTCCCATTTGTGTCCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5252Mimulus unigene:MlU1840Phytome id:
 Arabidopsis homolog:At1g16290
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGTAGCGGCTTAGAGCTTCCOvergo seq fw:
Reverse primer:TGCTGTCTCTGAGATGGTTAGCOvergo seq rv:
Tm:61.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5254Mimulus unigene:MlU1871Phytome id:
 Arabidopsis homolog:At2g07360
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 44.60cM

Set:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GACCCAAACTGTGGATTGCOvergo seq fw:
Reverse primer:AGATCATCTGGGTCTTCATCCOvergo seq rv:
Tm:58.9Tm:
IM62 length0BAC contig(s):
    
MlSTS5256Mimulus unigene:MlU1890Phytome id:
 Arabidopsis homolog:At1g45000
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCTCGATTCAAGCTTCTTAGCOvergo seq fw:
Reverse primer:GATCATGGCGACAAATAGACCOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5257Mimulus unigene:MlU1903Phytome id:
 Arabidopsis homolog:At5g33320
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACGGCCTAAAATCAGTGGOvergo seq fw:
Reverse primer:TCGGTACAAGCGAAGAAACCOvergo seq rv:
Tm:59.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5258Mimulus unigene:MlU1908Phytome id:
 Arabidopsis homolog:At1g23800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGTGTAGCTCCCGATTCCOvergo seq fw:
Reverse primer:TCGAGTTAGCTGCGAAAAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5259Mimulus unigene:MlU1915Phytome id:
 Arabidopsis homolog:At5g58420
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AAACATGTCCTGCGGTATCCOvergo seq fw:
Reverse primer:CTATCCAGCAGGTTTCATGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5260Mimulus unigene:MlU1919Phytome id:
 Arabidopsis homolog:At5g54770
Genetic markerPhysical marker
Map:Not MappedSet:F
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACGACATCATCGGACTCTGCOvergo seq fw:GCTTTCTGCCCCGAAATCATCATT
Reverse primer:GCGCTTGTCTCCATGAACCOvergo seq rv: GGCCAACATTTGGAGCAATGATGA
Tm:61.3Tm:65.40
IM62 length0BAC contig(s):
    
MlSTS5261Mimulus unigene:MlU1925Phytome id:
 Arabidopsis homolog:At1g53750
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ATACATTCCCGCTTCTGTGCOvergo seq fw:
Reverse primer:TGGTGACAATGAGGTTCAGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5262Mimulus unigene:MlU1931Phytome id:
 Arabidopsis homolog:At1g23440
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGTTTCCTCGTCGACTCTCGOvergo seq fw:
Reverse primer:CACCTCGGCCTAAGTAGTGGOvergo seq rv:
Tm:59.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5263Mimulus unigene:MlU1945Phytome id:
 Arabidopsis homolog:At3g60450
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCTACTGTCTCTTGCCATTTCGOvergo seq fw:
Reverse primer:CCATCGGGTTATTGTGTCGOvergo seq rv:
Tm:59.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5264Mimulus unigene:MlU1953Phytome id:
 Arabidopsis homolog:At1g30690
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GAGAGCCAAGAACCATGACGOvergo seq fw:
Reverse primer:TCTGGAAGACCCTGAAATGGOvergo seq rv:
Tm:60.8Tm:
IM62 length0BAC contig(s):
    
MlSTS5265Mimulus unigene:MlU1966Phytome id:
 Arabidopsis homolog:At3g13930
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AATTGCTTGATGCCAAAAGGOvergo seq fw:
Reverse primer:TGGCCCTGAGAAAAGTTCCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5266Mimulus unigene:MlU2004Phytome id:
 Arabidopsis homolog:At1g43170
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GTTTCTCCTCGGTTGTCTGGOvergo seq fw:
Reverse primer:AAAACCCACAGAGGTCTTCGOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5267Mimulus unigene:MlU2005Phytome id:
 Arabidopsis homolog:At2g22240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CATGTCATCCACGACATTGCOvergo seq fw:
Reverse primer:TTTTGTGGACAGCAAACACGOvergo seq rv:
Tm:61.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5268Mimulus unigene:MlU2033Phytome id:
 Arabidopsis homolog:At2g28490
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTCACCCCTTAAACATGACGOvergo seq fw:
Reverse primer:GAACCCGAAGAACTCAAACGOvergo seq rv:
Tm:58.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5269Mimulus unigene:MlU2040Phytome id:
 Arabidopsis homolog:At2g38670
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCATTATTGGTGCTCCTTGGOvergo seq fw:
Reverse primer:GCTTCTTTCTTGGCATTTCGOvergo seq rv:
Tm:58.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5270Mimulus unigene:MlU2056Phytome id:
 Arabidopsis homolog:At4g17510
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGAATCCATTTTTGCAGTGGOvergo seq fw:
Reverse primer:CCATACTCGCAGTGTTGTTCCOvergo seq rv:
Tm:60.3Tm:
IM62 length0BAC contig(s):
    
MlSTS5271Mimulus unigene:MlU2075Phytome id:
 Arabidopsis homolog:At3g28007
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CAAGACCTCGACTTGGTTCCOvergo seq fw:
Reverse primer:CAAACCGGACCCTTACTTAGCOvergo seq rv:
Tm:59.7Tm:
IM62 length0BAC contig(s):
    
MlSTS5272Mimulus unigene:MlU2077Phytome id:
 Arabidopsis homolog:At2g39800
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TTGCTGGATGTAGCTGATGCOvergo seq fw:
Reverse primer:TGATCAAAAGAACACCCAAGGOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5273Mimulus unigene:MlU2083Phytome id:
 Arabidopsis homolog:At1g12640
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CGATTATTATTTCGGGTTTGGOvergo seq fw:
Reverse primer:GAACCGGCAATCATTGTAGCOvergo seq rv:
Tm:58.4Tm:
IM62 length0BAC contig(s):
    
MlSTS5274Mimulus unigene:MlU2122Phytome id:
 Arabidopsis homolog:At5g34850
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GGCTTGTCAGAAGGAAAATACGOvergo seq fw:
Reverse primer:TAGCATCAGCACCAGTCTGCOvergo seq rv:
Tm:60.1Tm:
IM62 length0BAC contig(s):
    
MlSTS5275Mimulus unigene:MlU2127Phytome id:
 Arabidopsis homolog:At4g10040
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:CCACACCGTCGACAAAGGOvergo seq fw:
Reverse primer:TTCTCTCCCCAGGTAACAGCOvergo seq rv:
Tm:61.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5276Mimulus unigene:MlU2131Phytome id:
 Arabidopsis homolog:At5g54570
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TCATCCTGTAAAGCCTTGTCCOvergo seq fw:
Reverse primer:GATGCCTCCTCTGACTCTGCOvergo seq rv:
Tm:59.2Tm:
IM62 length0BAC contig(s):
    
MlSTS5278Mimulus unigene:MlU2167Phytome id:
 Arabidopsis homolog:At3g19940
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GCCACCACACAAAAATTCGOvergo seq fw:
Reverse primer:GCATCTCTCTGGCTTCATCCOvergo seq rv:
Tm:60.0Tm:
IM62 length0BAC contig(s):
    
MlSTS5279Mimulus unigene:MlU2186Phytome id:
 Arabidopsis homolog:At5g24530
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:AGGGATTAGAAGGCCACTCGOvergo seq fw:
Reverse primer:GACGCCTGTCGAGAATATGGOvergo seq rv:
Tm:60.6Tm:
IM62 length0BAC contig(s):
    
MlSTS5280Mimulus unigene:MlU2187Phytome id:
 Arabidopsis homolog:At4g18240
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:GATGCCCCTTTGGATAAACCOvergo seq fw:
Reverse primer:AGTTTGCTTCAGCCTGATCGOvergo seq rv:
Tm:60.5Tm:
IM62 length0BAC contig(s):
    
MlSTS5281Mimulus unigene:MlU2190Phytome id:
 Arabidopsis homolog:At3g48880
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:TGGTGGGTTTGATATGCTAGGOvergo seq fw:
Reverse primer:CTTCATCAAGATCCCGTTGGOvergo seq rv:
Tm:59.8Tm:
IM62 length0BAC contig(s):