Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (100 - 199) out of 1979 markers

MgSTS101Mimulus unigene:MgU177Phytome id:
 Arabidopsis homolog:At1g69410
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCATGTCAACCGTACTGACOvergo seq fw:CTCCCATGGCAGACATAACACTCA
Reverse primer:TTTCCTTCACCAAAGCCATCOvergo seq rv: GGAAAGGACCTTGTTGTGAGTGTT
Tm:Tm:65.40
IM62 length355?BAC contig(s):
    
MgSTS102Mimulus unigene:MgU199Phytome id:mgut825
 Arabidopsis homolog:At2g19520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 27.78cM

Set:B / C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCTGAACCGTTTGTGCTTTOvergo seq fw:GTACCACCGCCATTCCATAAGTCT
Reverse primer:AGATTGGGTTGCTTCTGTGGOvergo seq rv: GTGTGTCAGATGATGGAGACTTAT
Tm:Tm:65.40
IM62 length236?257?BAC contig(s):MgFPC1525, MgFPC1900, MgFPC2149, MgFPC231, MgFPC88, MlFPC1155
    
MgSTS103Mimulus unigene:MgU214Phytome id:
 Arabidopsis homolog:At1g53280
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTAGTTGCCGATGTTCTCCOvergo seq fw:GGTCCGACAGTTTACTGCACATTG
Reverse primer:GCTTGAGCACCACCTAGTCCOvergo seq rv: GCTACTGCTTTTCCTGCAATGTGC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS104Mimulus unigene:MgU239Phytome id:
 Arabidopsis homolog:At4g03280
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 41.20cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCGAACCCTTACACAAGGACOvergo seq fw:GCGGGTCCCCTAACAACTCTTCCT
Reverse primer:GGCACAACACAACCAAGATGOvergo seq rv: CTCAATACAACAACCAAGGAAGAG
Tm:Tm:65.40
IM62 length492BAC contig(s):MlFPC1052, MlFPC1055, MlFPC235
    
MgSTS105Mimulus unigene:MgU244Phytome id:
 Arabidopsis homolog:At2g39770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 63.50cM
M. guttatus Irn Mtn Combined(2009)6 37.96cM
M. guttatus IM62_x_DUN RILs(2009)6 62.10cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 61.98cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCCAAGCCACTTGTTGATTTOvergo seq fw:GTGCCCAAGCCACTTGTTGATTTC
Reverse primer:AGCCAGGACAACTTCAGTCACOvergo seq rv: TCATGGGCTTGTTAGCGAAATCAA
Tm:Tm:65.40
IM62 length284BAC contig(s):MgFPC2601, MgFPC2801, MlFPC559
    
MgSTS106Mimulus unigene:MgU248Phytome id:
 Arabidopsis homolog:At5g63890
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 73.10cM
M. guttatus Irn Mtn Combined(2009)2 52.47cM
M. guttatus IM62_x_DUN RILs(2009)2 59.96cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 44.47cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCCCCGGATAGATTTTTCATOvergo seq fw:GGTTGATAGCCTCAAAGCTCGCCC
Reverse primer:ACAGCTGCATCGCCTCTAGTOvergo seq rv: TGAAAAATCTATCCGGGGGCGAGC
Tm:Tm:65.40
IM62 length187BAC contig(s):MgFPC451, MlFPC1655
    
MgSTS107Mimulus unigene:MgU252Phytome id:
 Arabidopsis homolog:At3g51460
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCATTTTGAGCGTCTTTCCAOvergo seq fw:CCTTGATGTTGCACTGATTGCACG
Reverse primer:GACTCCAACTTGCCCTTCAAOvergo seq rv: TCTCCTAGTGCATCTTCGTGCAAT
Tm:Tm:64.38
IM62 length>1000BAC contig(s):
    
MgSTS108Mimulus unigene:MgU254Phytome id:mgut1028
 Arabidopsis homolog:At5g13450
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGTGCCGCTCCTGTTAAAGAOvergo seq fw:CTAAATTCGACAACGAGCCCACCC
Reverse primer:TGCGATGTACAAAGCCGTAGOvergo seq rv: TTGATCCGAGTATCCTGGGTGGGC
Tm:Tm:65.40
IM62 length888BAC contig(s):
    
MgSTS109Mimulus unigene:MgU255Phytome id:
 Arabidopsis homolog:At3g09630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)10 87.12cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 90.30cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCCGAGAGGATCAAGGCTAAOvergo seq fw:TGTCTTGTACCACGACTTGCTAGC
Reverse primer:CTAGCTCCATGGATCGCTGTOvergo seq rv: AACAGCGATCCATGGAGCTAGCAA
Tm:Tm:65.40
IM62 length795BAC contig(s):MgFPC2938, MgFPC478, MlFPC809
    
MgSTS110Mimulus unigene:MgU259Phytome id:mgut1045
 Arabidopsis homolog:At1g67730
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:GAGAGGGGCGATTGTGAATAOvergo seq fw:GCGCCGCCATTGTTATTCCTTCCG
Reverse primer:TAGAGGCCCCTTGAGAACTGOvergo seq rv: ACAGAGTAAAGAGGATCGGAAGGA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS111Mimulus unigene:MgU262Phytome id:
 Arabidopsis homolog:At3g09200
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGAATCCACTCCGACAACAOvergo seq fw:GACTGAAACCAAGGTCCTCATCAG
Reverse primer:TTGAACTTGGCAACCTCCTCOvergo seq rv: GAACCTGTCGATGAATCTGATGAG
Tm:Tm:64.38
IM62 length>1000BAC contig(s):
    
MgSTS112Mimulus unigene:MgU266Phytome id:
 Arabidopsis homolog:At3g29200
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 151.76cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTGTAGCCGAGGCAAAGTTOvergo seq fw:CCACCCGTTTCTCAATTGCTTTCT
Reverse primer:GATCTCCACCCGTTTCTCAAOvergo seq rv: ACATACCCGGAAGTGGAGAAAGCA
Tm:Tm:65.40
IM62 length932BAC contig(s):MgFPC3005, MgFPC3063
    
MgSTS113Mimulus unigene:MgU295Phytome id:
 Arabidopsis homolog:At3g25805
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)12 58.20cM
M. guttatus IM62_x_DUN RILs(2009)12 62.88cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACATTCTTTGGGGCTTTCAOvergo seq fw:CCTCGTCAGCCTCGTTCAGACGTA
Reverse primer:AGGCGCTCCTTTCATCATAAOvergo seq rv: ATTCCTTACATGGCTATACGTCTG
Tm:Tm:65.40
IM62 length252BAC contig(s):
    
MgSTS114Mimulus unigene:MgU297Phytome id:mgut1161
 Arabidopsis homolog:At3g23760
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGATGGATTCCTCTGCAAOvergo seq fw:AATAATTCGCGCCGTCGAGCCAAT
Reverse primer:TCTAGCACTTTCCCCACCTCOvergo seq rv: GGAATTCTGAGCCCTAATTGGCTC
Tm:Tm:65.40
IM62 length281BAC contig(s):
    
MgSTS115Mimulus unigene:MgU337Phytome id:
 Arabidopsis homolog:At1g69030
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATCTCACCCAGTGGCAAGAAOvergo seq fw:CCTCGATGTCTCCAAGAAGAAATG
Reverse primer:TTCCGTTCTTTCATCACTCGOvergo seq rv: GAGCAGGATTTGGACGCATTTCTT
Tm:Tm:65.40
IM62 length>1000BAC contig(s):
    
MgSTS116Mimulus unigene:MgU366Phytome id:
 Arabidopsis homolog:At4g34215
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATTCACAATGTGCGTCAAGAOvergo seq fw:GCTGCAATCCCTTAGCATCCACAC
Reverse primer:CCATGTATTTTGCATCTCCTGAOvergo seq rv: GTCCCAAATGTAGTGTGTGTGGAT
Tm:Tm:65.40
IM62 length>1000BAC contig(s):
    
MgSTS117Mimulus unigene:MgU427Phytome id:
 Arabidopsis homolog:At1g50740
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCTGGATCATGGGACAGAGOvergo seq fw:GCCGGTTATGTCAGCCTCCAAGCT
Reverse primer:ATATGGTTCCCACCAGTTGCOvergo seq rv: TTTTGCGTTTGTGGAAAGCTTGGA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS118Mimulus unigene:MgU444Phytome id:
 Arabidopsis homolog:At1g06820
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGCTCCTGAAGGAAACCACAOvergo seq fw:CCAACCGAGTAGCCCAAGTAGACC
Reverse primer:ATTATCTTTGCCGCCACAACOvergo seq rv: CAAAGTTCTTGATACCGGTCTACT
Tm:Tm:65.40
IM62 length240?BAC contig(s):
    
MgSTS119Mimulus unigene:MgU449Phytome id:
 Arabidopsis homolog:At2g28190
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAATACGGAGACACCACCAAOvergo seq fw:
Reverse primer:GCTCCGTGTGTCAAACCATTOvergo seq rv:
Tm:Tm:
IM62 length183BAC contig(s):
    
MgSTS120Mimulus unigene:MgU471Phytome id:
 Arabidopsis homolog:At3g10970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 51.50cM
M. guttatus IM62_x_DUN RILs(2009)6 40.80cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 73.46cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTAACGGGTTCCCCAATTTOvergo seq fw:GAAAATGGGCAGCTTAACGGGTTC
Reverse primer:TTCCCCATATTCAGCTCCAAOvergo seq rv: TGTCGGGTAAATTGGGGAACCCGT
Tm:Tm:65.40
IM62 length177BAC contig(s):
    
MgSTS121Mimulus unigene:MgU479Phytome id:
 Arabidopsis homolog:At4g36130
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 94.52cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTTCCCACAACCCTGACAAOvergo seq fw:CACTTGGCACAATCTTCTTGGCTC
Reverse primer:GCCACTTGGCACAATCTTCTOvergo seq rv: GTTAAGCTCCCATCTGGAGCCAAG
Tm:Tm:65.40
IM62 length859.6BAC contig(s):
    
MgSTS122Mimulus unigene:MgU484Phytome id:
 Arabidopsis homolog:At1g32060
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 99.73cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GGACACAGCCTTGAAAGCATOvergo seq fw:TCCAGTCTGTCGAATTGCCCGTCC
Reverse primer:ATCACTGCGTCTGCGTATTGOvergo seq rv: TCTCGGTATTGGAAATGGACGGGC
Tm:Tm:65.40
IM62 length613BAC contig(s):MlFPC327, MlFPC382
    
MgSTS123Mimulus unigene:MgU503Phytome id:
 Arabidopsis homolog:At1g70370
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAATGCTCCTCCTCCTCCTCOvergo seq fw:CGGTGCGGTCGTGAGTTTCAAGAG
Reverse primer:CCAACGCCACGTTAAAAGATOvergo seq rv: GGAATCGTTTCTGTAACTCTTGAA
Tm:Tm:65.40
IM62 length61?BAC contig(s):
    
MgSTS124Mimulus unigene:MgU507Phytome id:
 Arabidopsis homolog:At4g24220
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 18.09cM
M. guttatus IM62_x_DUN RILs(2009)2 10.18cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTGGTGGGCTGGAGCTATCOvergo seq fw:CGGCTTGATGCTTCTGCTGTGGCT
Reverse primer:TTCTGCTGTGGCTCATCTTCOvergo seq rv: AAAATCGACGAAGATGAGCCACAG
Tm:Tm:65.40
IM62 length157BAC contig(s):MgFPC24, MgFPC2453, MgFPC2747, MgFPC2768, MgFPC2851, MgFPC3063, MgFPC3069, MgFPC555, MgFPC64
    
MgSTS125Mimulus unigene:MgU527Phytome id:
 Arabidopsis homolog:At4g25630
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCTCTGCACGAAGAACATGGOvergo seq fw:GCAAACACTGCCTCAGCTGGTACA
Reverse primer:TTAGAACGGAAGGGATTCCAOvergo seq rv: ACTGTATCGATTCGACTGTACCAG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS126Mimulus unigene:MgU538Phytome id:
 Arabidopsis homolog:At3g12780
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TATCACCGATGACACCAGGAOvergo seq fw:CCAGGATCAGAGCCGCCATTCCAA
Reverse primer:AGGTGCGAGGCTGTATTTTGOvergo seq rv: ATCAAGTGTTTGATGGTTGGAATG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS127Mimulus unigene:MgU548Phytome id:
 Arabidopsis homolog:At2g20340
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCTCCCATCGGAGTTTCTOvergo seq fw:ACTACAAGAACGTCGAGAAATATC
Reverse primer:TTCTCCCTCCCGATCTTCTTOvergo seq rv: ACCTGGCTCCGAACCGGATATTTC
Tm:Tm:65.40
IM62 length125BAC contig(s):
    
MgSTS128Mimulus unigene:MgU79Phytome id:
 Arabidopsis homolog:At3g29200
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGGATTCCATGGCTCTTTOvergo seq fw:CACCGCTGGATATGTCAGCAACTC
Reverse primer:AATGTTCGTCCGGACTCTTGOvergo seq rv: TAAAGGCCGATTGATGGAGTTGCT
Tm:Tm:65.40
IM62 length184BAC contig(s):
    
MgSTS129Mimulus unigene:MgU81Phytome id:
 Arabidopsis homolog:At2g36530
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGGAGCTTCTTCATTCAAGGOvergo seq fw:GGCTCCTGCATAAACTGCTTCCGA
Reverse primer:GGTTGCGTCTTGTCCGTACTOvergo seq rv: TGAAGAGGAACTTGGTTCGGAAGC
Tm:Tm:65.40
IM62 length95BAC contig(s):
    
MgSTS130Mimulus unigene:MgU82Phytome id:
 Arabidopsis homolog:At1g22410
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 133.43cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACTCGCCCCTTCGATTCTATOvergo seq fw:AGTCATCGAATGTCACGGTTCTTG
Reverse primer:TCCGGGATGACTTCCTTCTTOvergo seq rv: GAATGCATCGGAGGGTCAAGAACC
Tm:Tm:65.40
IM62 length587BAC contig(s):MgFPC561, MlFPC533
    
MgSTS131Mimulus unigene:MgU91Phytome id:mgut4268
 Arabidopsis homolog:At4g33510
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GGAGTTCAATGCCAACAACAOvergo seq fw:GCGCTGTTCTCATGTTCGGCGGTC
Reverse primer:TGCTCCTCGAATGGATCTGOvergo seq rv: TTTATAACGGGAACTTGACCGCCG
Tm:Tm:65.40
IM62 length433BAC contig(s):
    
MgSTS132Mimulus unigene:MgU93Phytome id:
 Arabidopsis homolog:At3g63140
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)4 11.10cM
M. guttatus IM62_x_DUN RILs(2009)4 7.84cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 4.59cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GTAGCAGATTGGGCCAAGAGOvergo seq fw:CCAAGTATCTCCTTTGCAGCTCTC
Reverse primer:CGCCCAATTATCGAATGTCTOvergo seq rv: ATTTCTATGCGGAGCCGAGAGCTG
Tm:Tm:65.40
IM62 length246BAC contig(s):
    
MgSTS133Mimulus unigene:MgU95Phytome id:
 Arabidopsis homolog:At5g26110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 102.40cM
M. guttatus IM62_x_DUN RILs(2009)14 94.18cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 94.83cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGACAAAATCCTTGCTGCATOvergo seq fw:CGAAGACCACTGCTTTGAGGATTT
Reverse primer:CGCTTTCTTCCTCTTTGTCGOvergo seq rv: CCTTGCTGCATATAGGAAATCCTC
Tm:Tm:64.38
IM62 length225BAC contig(s):MlFPC1034, MlFPC1146, MlFPC376, MlFPC53
    
MgSTS134Mimulus unigene:MgU96Phytome id:mgut4618
 Arabidopsis homolog:At1g17100
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:GGCAAAATTGCCTTCTTTCAOvergo seq fw:
Reverse primer:GCTTGGTTCTTTGTCGGAACOvergo seq rv:
Tm:Tm:
IM62 lengthBAC contig(s):
    
MgSTS135Mimulus unigene:MgU911Phytome id:mgut4276
 Arabidopsis homolog:At2g20580
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AGAACTTGGCAGCGACATTTOvergo seq fw:GCCAGCTCGAAGAAGAACCACCAC
Reverse primer:CCAGCTCGAAGAAGAACCACOvergo seq rv: CCATCTGAAGTATCTAGTGGTGGT
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS136Mimulus unigene:MgU339Phytome id:
 Arabidopsis homolog:At4g35750
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCACGTTCTATTTCCTCCAOvergo seq fw:CAGAAACTCCACCCTGTTCACGTA
Reverse primer:CCACAGAAACTCCACCCTGTOvergo seq rv: GTACTGCAAGGTGAAGTACGTGAA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS137Mimulus unigene:MgU234Phytome id:
 Arabidopsis homolog:At3g16150
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 119.53cM

Set:D2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCTCTTCGTTCCTCTCACTOvergo seq fw:CAGGTGGATTCCATGCCGATCGTC
Reverse primer:ATGATGCTTGCCTCCATCTCOvergo seq rv: TTGATTACAGAATCCCGACGATCG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS138Mimulus unigene:MgU180Phytome id:
 Arabidopsis homolog:At3g13200
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTGTTGCGTGGAAATCCTCTOvergo seq fw:
Reverse primer:ACGAGCCTGGTTCTTGAAAAOvergo seq rv:
Tm:Tm:
IM62 lengthBAC contig(s):
    
MgSTS139Mimulus unigene:MgU342Phytome id:mgut1351
 Arabidopsis homolog:At5g19180
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTTCCGGAACCTTGATGTAOvergo seq fw:CTGCGTTTATGTAGCTCCGAGCCT
Reverse primer:TTCAGCCTTTGGCTTTCCTAOvergo seq rv: GGTCTTGATTCAATCGAGGCTCGG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS140Mimulus unigene:MgU58Phytome id:mgut2342
 Arabidopsis homolog:At1g80600
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGCATGTCAGCAACATTTTCOvergo seq fw:CACACAGCAAGCTGATGTGCTCAC
Reverse primer:CGGAGTTGCAGAAGAACACAOvergo seq rv: AATGTTGCTGACATGCGTGAGCAC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS141Mimulus unigene:MgU315Phytome id:
 Arabidopsis homolog:At5g60600
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTCGGAGCAGTTGACAAAGOvergo seq fw:TTGGCCAACCTTGGTATGAGAGCA
Reverse primer:CCACGCACAGAGACTACCAAOvergo seq rv: CTTTCTGAAGCTCAGCTGCTCTCA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS142Mimulus unigene:MgU765Phytome id:
 Arabidopsis homolog:At4g17390
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGCCTTAGGGTTCTCAACTOvergo seq fw:CGCACAGTTGTATGTGCTGGATCG
Reverse primer:CCAGTTGATTCTCGGGTCATOvergo seq rv: TCGAGGTGATTCTGATCGATCCAG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS143Mimulus unigene:MgU171Phytome id:
 Arabidopsis homolog:At4g34670
Genetic markerPhysical marker
Map:Not MappedSet:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCTCGGAAAGTTGATGGAOvergo seq fw:GGCTGCTCTGTCCAATTTCACACC
Reverse primer:CCAATTTCACACCGACCTCTOvergo seq rv: TTACACTGAAGAGGTCGGTGTGAA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS144Mimulus unigene:MgU1013Phytome id:
 Arabidopsis homolog:At1g04190
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACGAGCACAAGAAGTGGAAAOvergo seq fw:GGAGGGAAAAGCAGCGCAGATTTC
Reverse primer:GAACCATCTTCGGCTCCATAOvergo seq rv: TCCCTGATCTTTCAGTGAAATCTG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS145Mimulus unigene:MgU359Phytome id:
 Arabidopsis homolog:At1g73230
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGCTTCAGAGCACCTTGAOvergo seq fw:CAGGTGCCTGCTTCTGGAACTGCT
Reverse primer:TTGGCAGCAATAGATGCTTGOvergo seq rv: TTGAAGAAATTGGCAGAGCAGTTC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS146Mimulus unigene:MgU318Phytome id:mgut1237
 Arabidopsis homolog:At3g48420
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATTTGTACGGCGAATTGCTOvergo seq fw:GGGTCTCCGATGCAGTCGAAAATC
Reverse primer:CTTGTGGAGCGATGCTATGAOvergo seq rv: TTGTAAATGCCGATGCGATTTTCG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS147Mimulus unigene:MgU97Phytome id:mgut4702
 Arabidopsis homolog:At3g56170
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCAATGGCATATTTGTGCAGOvergo seq fw:ATCTCAGGGTTCGAAGACGCCCAT
Reverse primer:TTATCCAACTCTGGGCGTCTOvergo seq rv: CGAAACGGATTGGTTTATGGGCGT
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS148Mimulus unigene:MgU760Phytome id:mgut3269
 Arabidopsis homolog:At1g11870
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACTATGGACATGGCGACACAOvergo seq fw:CGCCTGCTTTGATAGTCTGTGCAG
Reverse primer:TCGCCTGCTTTGATAGTCTGOvergo seq rv: TTTCAAGCGCCTCTAACTGCACAG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS149Mimulus unigene:MgU788Phytome id:mgut3417
 Arabidopsis homolog:At1g11870
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCGCCAGAAACTAATCGAAGOvergo seq fw:CCGCAACTTCAATGCTAACCTCGA
Reverse primer:CCACCTATTGGGACATCTGGOvergo seq rv: GAGCTCAAGAACAAGGTCGAGGTT
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS150Mimulus unigene:MgU915Phytome id:mgut4304
 Arabidopsis homolog:At5g54080
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTCCGCCCTCCGTATTATCOvergo seq fw:CGGAAATTCTTTTCGGTCCTGCTT
Reverse primer:TTGTGTCTGGACCATGAGGAOvergo seq rv: ATAGCGCTCGGAAACGAAGCAGGA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS151Mimulus unigene:MgU426Phytome id:
 Arabidopsis homolog:At3g27060
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGATTCCGACGAGAAGAACAOvergo seq fw:TAAAGGATTCCGACGAGAAGAACA
Reverse primer:CAGAAGCTTCCGGAGAAGAAOvergo seq rv: ATTGCGCGGAAGAGCCTGTTCTTC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS152Mimulus unigene:MgU787Phytome id:mgut3411
 Arabidopsis homolog:At1g12470
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTGTTGATCCCGGAGGTAGOvergo seq fw:ATGACGTCATTGTGCTGGGAACCA
Reverse primer:TTGGCCATTGTCTGTACCAAOvergo seq rv: ATGACCCAGCCTTTGCTGGTTCCC
Tm:Tm:66.43
IM62 lengthBAC contig(s):
    
MgSTS153Mimulus unigene:MgU1099Phytome id:mgut492
 Arabidopsis homolog:At4g25970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)2 35.24cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)2 27.55cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:TTGCTATCGGAGCAACAATGOvergo seq fw:
Reverse primer:GCCGAACGAGAAATATCCAAOvergo seq rv:
Tm:Tm:
IM62 lengthBAC contig(s):
    
MgSTS154Mimulus unigene:MgU1009Phytome id:
 Arabidopsis homolog:At1g64970
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCAATCCCACTCTTTCGAGOvergo seq fw:CGGCCAAAATGGAGCAACGTACTG
Reverse primer:ATCCCTTTCCATGTGAGTGCOvergo seq rv: GTTTGAAGATTGGTCGCAGTACGT
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS155Mimulus unigene:MgU771Phytome id:mgut3324
 Arabidopsis homolog:At4g29840
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GATCTCGGCATGACCGTATTOvergo seq fw:
Reverse primer:GGAAGACGATGGATGGGATTOvergo seq rv:
Tm:Tm:
IM62 lengthBAC contig(s):
    
MgSTS156Mimulus unigene:MgU1100Phytome id:mgut495
 Arabidopsis homolog:At1g43170
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCGCTTTCTTGGGTTACAOvergo seq fw:ACAGGAAGTTTGAGCACCCAAGGC
Reverse primer:CAGCCTCACAGGTTTCCTTCOvergo seq rv: AAACCGAGGGAACCGTGCCTTGGG
Tm:Tm:67.45
IM62 lengthBAC contig(s):
    
MgSTS157Mimulus unigene:MgU954Phytome id:mgut4574
 Arabidopsis homolog:At3g50820
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCTACACCCTGGACGAAAOvergo seq fw:TCAGTCCGATCTCAAAGACTTGGC
Reverse primer:CGTCCTTCTCCTCGAACTTGOvergo seq rv: ATCGGTGCATTTCTGGGCCAAGTC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS158Mimulus unigene:MgU202Phytome id:
 Arabidopsis homolog:At1g11860
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTGGCACATTCACGATGAGOvergo seq fw:TTCTTGGCACATTCACGATGAGAG
Reverse primer:CGAAACCATCTTCACCTGTGTOvergo seq rv: GAGAGCCAAAAGCGACCTCTCATC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS159Mimulus unigene:MgU670Phytome id:mgut2766
 Arabidopsis homolog:At5g37510
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAACCTTGGACCTTTGGTCAOvergo seq fw:GGGGAGAGTGTGATCTCCAGGATC
Reverse primer:CTTGAACACCGGCAATTTCTOvergo seq rv: CCAAAAGCCATAGATTGATCCTGG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS160Mimulus unigene:MgU106Phytome id:mgut442
 Arabidopsis homolog:At2g24270
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGCAATGCTAGCAACTTCGOvergo seq fw:GGGCTTGGCAAGTTGATCACAGTG
Reverse primer:TGGAAAGGGAAATGATCTGGOvergo seq rv: TGACAAAGGTGAAGAGCACTGTGA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS161Mimulus unigene:MgU540Phytome id:
 Arabidopsis homolog:At2g39730
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTCTGCCTCGGTATCTTCCOvergo seq fw:TTCGTCGTCGTACACTCTTGCCCT
Reverse primer:TCGTCGTCGTACACTCTTGCOvergo seq rv: TTTCTTCGGTGCATTGAGGGCAAG
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS169Mimulus unigene:MgU138Phytome id:
 Arabidopsis homolog:At1g11920
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACGTGTGCGTATCCTAACCOvergo seq fw:GCTCCCGTATCCCGATGGAACAAA
Reverse primer:GGACACGAGGATAACAATTTGGOvergo seq rv: CTTCAACGGTGCATATTTTGTTCC
Tm:59.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS170Mimulus unigene:MgU145Phytome id:mgut679
 Arabidopsis homolog:At2g22900
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGGAAGATCTTATCTTTGAACGOvergo seq fw:TGAACGTAGCGCTCAGAATCTCGC
Reverse primer:CCATGGATTTCATTGACACGOvergo seq rv: GAATACGACAAATGGGGCGAGATT
Tm:61.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS172Mimulus unigene:MgU156Phytome id:mgut702
 Arabidopsis homolog:At2g27040
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAAGTCGAGATCAGCTTTGCOvergo seq fw:CTCGAGTTCACTGTTGTTCTTGAG
Reverse primer:GGCGAACCAACAAACAACCOvergo seq rv: TGCTCGAGGTAACGTCCTCAAGAA
Tm:58.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS173Mimulus unigene:MgU165Phytome id:
 Arabidopsis homolog:At3g50070
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 5.21cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 31.48cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCAATCTTCAACCTTTTCCOvergo seq fw:GCAGGATCTACGGCTCAGATTGTC
Reverse primer:AGGCTGGTGGCTTATCTTCCOvergo seq rv: CATCACCGATGTAATGGACAATCT
Tm:58.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS174Mimulus unigene:MgU167Phytome id:
 Arabidopsis homolog:At2g33570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 90.86cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTCTCGAATCCCCATTGCOvergo seq fw:GCGTTCCTCGCCTGAATTGCGTAT
Reverse primer:CAGTCCTCCACGACTTCTCCOvergo seq rv: TAAGGAGAGATCGGAAATACGCAA
Tm:60.5Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS176Mimulus unigene:MgU190Phytome id:
 Arabidopsis homolog:At3g19910
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 56.64cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 48.30cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCTGAGCATTACTACCATGCOvergo seq fw:ATTGCGTCTGCCGAAAGACCCCTA
Reverse primer:TGGCAGCTAGATTGTTAGCCOvergo seq rv: TCATTGGAACAGAGAGTAGGGGTC
Tm:57.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS178Mimulus unigene:MgU193Phytome id:
 Arabidopsis homolog:At1g69780
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 9.72cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTCGTTGTCTTTGTTCAGGOvergo seq fw:ATTATCCCCACCGTTGACTCTCTC
Reverse primer:TGAAACGCCAGTTTGATGCOvergo seq rv: TGTGTCTGAAAGCAGCGAGAGAGT
Tm:58.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS179Mimulus unigene:MgU194Phytome id:
 Arabidopsis homolog:At5g26250
Genetic markerPhysical marker
Map:Not MappedSet:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACGAAAAGGCAGACAAGCOvergo seq fw:CCGTCGGCTTCAAGTGGACTAGTA
Reverse primer:AGGAAATTGCTCCTCCAAGCOvergo seq rv: GGAGTTGGATCAATTCTACTAGTC
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS180Mimulus unigene:MgU201Phytome id:
 Arabidopsis homolog:At1g49760
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 55.20cM

Set:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCTTGCAAATGCTTCTCCOvergo seq fw:ACAAATATTCTACGGACAGCCACC
Reverse primer:CATGCCTGTCACCTTTGCOvergo seq rv: AGGAAGCATGGCTGGTGGTGGCTG
Tm:60.1Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS184Mimulus unigene:MgU225Phytome id:
 Arabidopsis homolog:At1g15820
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 32.25cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCTCCGCCTCTCTGTACCOvergo seq fw:TTAGGAAAGACGGGTCTTTTCCGA
Reverse primer:ACCCCGAGTGGCTAGATGGOvergo seq rv: TTCGACCCATTGGGACTCGGAAAA
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS185Mimulus unigene:MgU230Phytome id:
 Arabidopsis homolog:At4g38220
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 88.45cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCATAAGCTTTGATTATTGACTCGOvergo seq fw:CCCAAGTTCCCTGAAATAGCGAGC
Reverse primer:TTCTCCTATGGCAAACACACCOvergo seq rv: TCCTGCTTCAACAGATGCTCGCTA
Tm:59.4Tm:65.40
IM62 lengthBAC contig(s):MgFPC606, MlFPC565
    
MgSTS190Mimulus unigene:MgU251Phytome id:mgut1017
 Arabidopsis homolog:At2g04842
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 59.26cM

Set:B / C2 / D2
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:GGTCCTTGGATTGAGAATGGOvergo seq fw:GCGGGACCACCGTAGAATTGGTCA
Reverse primer:TTTTATGGGCTTCATCTCTGCOvergo seq rv: AAACAGATCGAGATCTTGACCAAT
Tm:59.3Tm:65.40
IM62 lengthBAC contig(s):MlFPC1361, MlFPC499
    
MgSTS192Mimulus unigene:MgU272Phytome id:
 Arabidopsis homolog:At2g45400
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGGCCCGAAAATTTCACCOvergo seq fw:CCTCCAGCCCATTCTCGTACTTGA
Reverse primer:GAATATCCAGGGGCAAAAGGOvergo seq rv: CTCGAAGAAACTGGATTCAAGTAC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS193Mimulus unigene:MgU274Phytome id:mgut1096
 Arabidopsis homolog:At4g03210
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTCTGAACAAGGTAGGGTTCCOvergo seq fw:CTCCAGGTTTGTGTGTACTCTCAC
Reverse primer:CTTGTTGAGGGTGACTCTGCOvergo seq rv: GGTAGATGAGACACCAGTGAGAGT
Tm:60.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS194Mimulus unigene:MgU275Phytome id:
 Arabidopsis homolog:At3g01280
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGGCTCGTCAACAGTGAAGGOvergo seq fw:TGTGGAAGTAGGACGCAGTGACAG
Reverse primer:TTCGTCTGGAACTCAGAAAGGOvergo seq rv: AGTGATAAGGGCGAAACTGTCACT
Tm:60.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS195Mimulus unigene:MgU280Phytome id:
 Arabidopsis homolog:At4g18930
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCATAGAGTAGGCTCAAGTGCOvergo seq fw:CGTCGGTTAAATCTCCATAGAGTA
Reverse primer:TCAGTGCGTTCTTCTTCTGCOvergo seq rv: ATGCCGCACTTGAGCCTACTCTAT
Tm:58.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS198Mimulus unigene:MgU287Phytome id:mgut1141
 Arabidopsis homolog:At1g62740
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)1 71.05cM
M. guttatus IM62_x_DUN RILs(2009)1 59.29cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CTTGGAAATCGGACAACACCOvergo seq fw:
Reverse primer:CTAGCCGTGGAGATTTGACCOvergo seq rv:
Tm:60.4Tm:
IM62 lengthBAC contig(s):
    
MgSTS200Mimulus unigene:MgU24Phytome id:mgut964
 Arabidopsis homolog:At4g12290
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)1 86.65cM

Set:
Guttatus map status:polymorphic by sizePhys map status:overgo designed but not yet included in a set
Forward primer:CCAACGTGTACCACACAACGOvergo seq fw:
Reverse primer:ATAATGACACGGAGCAATGGOvergo seq rv:
Tm:60.9Tm:
IM62 lengthBAC contig(s):
    
MgSTS201Mimulus unigene:MgU478Phytome id:mgut1912
 Arabidopsis homolog:At5g24580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)6 0.00cM

Set:C / C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CACCTCATTCTTCTTCATGTCGOvergo seq fw:GGCGTCCATTGTTCCCGTCACCGT
Reverse primer:AGGCGAAGAAAGACGAGAGCOvergo seq rv: AAGTTCGAGTAAAGTTACGGTGAC
Tm:59.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS202Mimulus unigene:MgU487Phytome id:
 Arabidopsis homolog:At3g54400
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGTAGCACGTGTCGAACCOvergo seq fw:ATGAGTATGCGGTGGTTCTGCTGC
Reverse primer:CAGCCAATCAGAATCAAGACGOvergo seq rv: TGATCGCAAGCTTCCAGCAGCAGA
Tm:58.8Tm:66.43
IM62 lengthBAC contig(s):
    
MgSTS203Mimulus unigene:MgU491Phytome id:
 Arabidopsis homolog:At1g31690
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTCACTTGGTTCATGTTGACGOvergo seq fw:CACGGTACGTGATGGAATCCCAAT
Reverse primer:GGATTGGGAGTTCCATGCOvergo seq rv: TCGTGTTGTGGTACACATTGGGAT
Tm:59.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS204Mimulus unigene:MgU493Phytome id:
 Arabidopsis homolog:At5g49180
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATCCATTATTGGCCAGTTGCOvergo seq fw:GTCCAGCAATGGTCTCGCTATGGT
Reverse primer:GGTGTTCTTCTTTGGGATGGOvergo seq rv: GGATGAAACATCGGAAACCATAGC
Tm:59.8Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS205Mimulus unigene:MgU495Phytome id:
 Arabidopsis homolog:At1g05310
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)9 35.82cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 42.52cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTACCGCTCCGTTTATCACCOvergo seq fw:GTGTCGTATTAGCTCCATCCCCTG
Reverse primer:CTATATCCAGGGCTCCATCGOvergo seq rv: GGAGAGTACAATTGCACAGGGGAT
Tm:60.0Tm:65.40
IM62 lengthBAC contig(s):MgFPC2389, MgFPC3199, MgFPC458, MlFPC1846, MlFPC291, MlFPC482
    
MgSTS206Mimulus unigene:MgU496Phytome id:
 Arabidopsis homolog:At3g19553
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGAATTCGAGGATTTCTTGGOvergo seq fw:CCGAACATAGAATGCTGAATGTGG
Reverse primer:GTGGTTCTTGGCTGAAATGGOvergo seq rv: TCGAAATACGGGACCCCCACATTC
Tm:58.6Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS207Mimulus unigene:MgU1292Phytome id:
 Arabidopsis homolog:At4g09800
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAACTTGCCATCCTTGTAATCCOvergo seq fw:TCTTCTTGGAGACACCAACAGTCT
Reverse primer:CAACATCGTCTGCAAGAAAGCOvergo seq rv: ACTGGTCGCAGGGGAAAGACTGTT
Tm:59.4Tm:66.43
IM62 lengthBAC contig(s):
    
MgSTS208Mimulus unigene:MgU1225Phytome id:
 Arabidopsis homolog:At5g14030
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:AACTCAAAGGAATGTGACACGOvergo seq fw:CCAGGTACACAAACAAAGCCACAC
Reverse primer:TGATGTGACACTTACTGATGATAGCOvergo seq rv: GTCTCAGTGACAACTGGTGTGGCT
Tm:57.7Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS209Mimulus unigene:MgU1497Phytome id:
 Arabidopsis homolog:At1g06680
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 26.15cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 57.03cM

Set:C / C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTGCTGATGCTGCTTATGGOvergo seq fw:ATCAGACGCCGTCGTTTCAAGGAG
Reverse primer:GAATCCTTCTCCGCTGTACGOvergo seq rv: AAGAGTGAGAGCCAATCTCCTTGA
Tm:61.9Tm:65.40
IM62 lengthBAC contig(s):MgFPC871, MlFPC102, MlFPC133, MlFPC1361, MlFPC22, MlFPC971
    
MgSTS210Mimulus unigene:MgU308Phytome id:
 Arabidopsis homolog:At5g20060
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATGGCCTCGGTGATAAAGGOvergo seq fw:AAGCAACGATAGTTTGGCTCCATG
Reverse primer:GGTTTTCCAAGATTTGTGACCOvergo seq rv: CCTTTATCACCGAGGCCATGGAGC
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS211Mimulus unigene:MgU1503Phytome id:
 Arabidopsis homolog:At2g34480
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCGTTGCTCTTCTTCACCOvergo seq fw:CGCAGCCAGATACCGTAGTTCTTG
Reverse primer:CCGAAGATCTATCGTATGAAGCOvergo seq rv: AGAACCCAACGACAATCAAGAACT
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS212Mimulus unigene:MgU1505Phytome id:
 Arabidopsis homolog:At4g30800
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)1 0.00cM
M. guttatus Irn Mtn Combined(2009)1 0.00cM
M. guttatus IM62_x_DUN RILs(2009)1 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCGCAGGAATATTTGAATGCOvergo seq fw:TGTAAAGGCCTTCTTCCCAAGACC
Reverse primer:CCGTTCACTGGTGATGTATCCOvergo seq rv: TCCAGCAGGTTCAACTGGTCTTGG
Tm:60.6Tm:65.40
IM62 lengthBAC contig(s):MgFPC351, MgFPC543
    
MgSTS213Mimulus unigene:MgU1509Phytome id:
 Arabidopsis homolog:At4g14320
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)4 83.74cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACATATGCTTGCAGCTCTGGOvergo seq fw:CCCTTTCCTTTCTTGTCCCCACCA
Reverse primer:TCAGACCAAGCCTGTTTTCCOvergo seq rv: GCAAGCATTTCGAGATTGGTGGGG
Tm:59.0Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS214Mimulus unigene:MgU203Phytome id:
 Arabidopsis homolog:At5g08640
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 26.10cM
M. guttatus Irn Mtn Combined(2009)3 10.42cM
M. guttatus IM62_x_DUN RILs(2009)3 48.27cM

Set:B / D2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGCTTTCTTCGGTCACAAGCOvergo seq fw:GCCAAGACATCCTCGTACTCTCCT
Reverse primer:GGGATGACAGTTGGTATGACGOvergo seq rv: AGGAGTACGGTGAATAAGGAGAGT
Tm:62.2Tm:65.40
IM62 lengthBAC contig(s):MgFPC2883, MgFPC2968, MlFPC130, MlFPC77
    
MgSTS215Mimulus unigene:MgU482Phytome id:
 Arabidopsis homolog:At4g39090
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTCGTTCAGCACAACTGGOvergo seq fw:AGTTCTCAGATTTGACCCCCGAGG
Reverse primer:CACACGAGTTAGCTTCATCTGGOvergo seq rv: TAGCTCTTCTCGAACTCCTCGGGG
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS216Mimulus unigene:MgU509Phytome id:
 Arabidopsis homolog:At4g26530
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCATTCGTAGGCAAGTACGOvergo seq fw:TATAAACGTGGAGAACATCGAATC
Reverse primer:ATACTCGAGAGGCGTTTTCCOvergo seq rv: GAGTGCCTGGCGGTTGGATTCGAT
Tm:59.9Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS217Mimulus unigene:MgU1513Phytome id:
 Arabidopsis homolog:At3g53020
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)9 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)9 87.29cM

Set:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCTGGACTACCATGTACCGOvergo seq fw:ATACCCCGGAAGAGGAATAAGGTT
Reverse primer:CCTTGAGTACGGCTTCTTCGOvergo seq rv: GGAGTCCGAGCGAATAAACCTTAT
Tm:57.4Tm:65.40
IM62 lengthBAC contig(s):MlFPC667, MlFPC774
    
MgSTS218Mimulus unigene:MgU511Phytome id:
 Arabidopsis homolog:At1g55180
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGATGGGAATCAAGTTCACGOvergo seq fw:CGTCCATTGATCTTTGATTCACGT
Reverse primer:CCACCGACAATAGGAATTGGOvergo seq rv: CTGATAGGCTCGGCGAACGTGAAT
Tm:61.4Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS219Mimulus unigene:MgU1262Phytome id:
 Arabidopsis homolog:At2g27530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 9.40cM
M. guttatus IM62_x_DUN RILs(2009)4 119.17cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAACACCCATGCAAAGAACCOvergo seq fw:CGTTGAGGTTTGCCCATAGTACTC
Reverse primer:CTTGCGAAGAAATACCATGCOvergo seq rv: GGTGCCTATACCTCAAGAGTACTA
Tm:61.3Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS220Mimulus unigene:MgU1516Phytome id:
 Arabidopsis homolog:At4g00100
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 86.60cM

Set:B
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCTCCACCAAAATCAACCOvergo seq fw:CGGTGAATCCTGCTCTCCACCAAA
Reverse primer:GCAAAGAAGGGGATGACTCCOvergo seq rv: CCAAGTTTCGGTTGATTTTGGTGG
Tm:59.5Tm:65.40
IM62 lengthBAC contig(s):MgFPC588, MlFPC1, MlFPC1550, MlFPC1581, MlFPC1748, MlFPC1808, MlFPC1882, MlFPC464, MlFPC71, MlFPC82, MlFPC869
    
MgSTS221Mimulus unigene:MgU1518Phytome id:
 Arabidopsis homolog:At4g27090
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGCTCCTGTCGAACAACACCOvergo seq fw:TCTTTCTTAAGCTTCGCAAGCTCC
Reverse primer:AGTGGGAAAAGAGCTCATGGOvergo seq rv: CCGGTGTTGTTCGACAGGAGCTTG
Tm:60.3Tm:65.40
IM62 lengthBAC contig(s):