Gene-Based markers

[0-99] [100-199] [200-299] [300-399] [400-499] [500-599] [600-699] [700-799] [800-899] [900-999] [1000-1099] [1100-1199] [1200-1299] [1300-1399] [1400-1499] [1500-1599] [1600-1699] [1700-1799] [1800-1899] [1900-1979]

Display (0 - 99) out of 1979 markers

MgSTS1Mimulus unigene:MgU537Phytome id:
 Arabidopsis homolog:At5g54770
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 84.66cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AATGGAAGTTGCCGAAATTGOvergo seq fw:ACGACTTCAAATTCCAGCCCATCA
Reverse primer:AATGCCAAGTGAGCTGCTTTOvergo seq rv: GCGACGATGGATTCCTTGATGGGC
Tm:Tm:65.40
IM62 length729(M13)BAC contig(s):MlFPC377, MlFPC711
    
MgSTS2Mimulus unigene:MgU803Phytome id:mgut3498
 Arabidopsis homolog:At3g12050
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCGGCGAGTTCAGTATTTTCOvergo seq fw:AATTGGGCTCCTCGAAAGTTAGCC
Reverse primer:AATTGGGCTCCTCGAAAGTTOvergo seq rv: ATTGTGTCCACGGTTCGGCTAACT
Tm:Tm:65.40
IM62 length842BAC contig(s):
    
MgSTS3Mimulus unigene:MgU876Phytome id:mgut4029
 Arabidopsis homolog:At3g54250
Genetic markerPhysical marker
Map:Not MappedSet:A
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTCACTCATGACCGCATGTOvergo seq fw:ATTCTCCCGATCAACGACAGCATT
Reverse primer:CCGGAGTTCCCTCAAACAATOvergo seq rv: GGTCGAGAGTAACGCTAATGCTGT
Tm:Tm:65.40
IM62 length708BAC contig(s):
    
MgSTS4Mimulus unigene:MgU881Phytome id:mgut4062
 Arabidopsis homolog:At4g14910
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 0.00cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGTTTGGAGACTTCTCAGCOvergo seq fw:CTTGACGAAAAGCCCTTGCAAAGG
Reverse primer:ACTCAAATGTGGCCTTCCAGOvergo seq rv: GAAGCAACCTTCAAGGCCTTTGCA
Tm:Tm:65.40
IM62 length768BAC contig(s):
    
MgSTS5Mimulus unigene:MgU958Phytome id:mgut4601
 Arabidopsis homolog:At3g54190
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAATCCGACACCGATGAGTCOvergo seq fw:GTTGCTCGCCTTGATTTTCGCTAG
Reverse primer:GGCATTTTCCGGTCAAGATAOvergo seq rv: CTTGACCGGAAAATGCCTAGCGAA
Tm:Tm:65.40
IM62 length859BAC contig(s):
    
MgSTS6Mimulus unigene:MgU1072Phytome id:mgut472
 Arabidopsis homolog:At2g13360
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACAACTTGGCCACCGTAAGOvergo seq fw:GACTGCTACTGGAGTTACCAACAA
Reverse primer:CCACATCTATTCCCCACTCGOvergo seq rv: TCTTACGGTGGCCAAGTTGTTGGT
Tm:Tm:65.40
IM62 length691BAC contig(s):
    
MgSTS7Mimulus unigene:MgU151Phytome id:
 Arabidopsis homolog:At5g12040
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 0.00cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AATCGCCTACTCCTCCCATCOvergo seq fw:CCAGCTGGTAAAGATCGCCTCGTC
Reverse primer:TCCTTAGCTTGTCGGCAGTTOvergo seq rv: CCATTAGAGAAGCAAAGACGAGGC
Tm:Tm:65.40
IM62 length639BAC contig(s):
    
MgSTS8Mimulus unigene:MgU183Phytome id:mgut778
 Arabidopsis homolog:At3g07670
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCTTCGTTCCTCCCTCTCOvergo seq fw:GTGGAGGTAGGAGAGAGAGGACTC
Reverse primer:ACTTCACCAGCCTCACGATTOvergo seq rv: TATTCTTCAAAGCGACGAGTCCTC
Tm:Tm:65.40
IM62 length745BAC contig(s):
    
MgSTS9Mimulus unigene:MgU242Phytome id:
 Arabidopsis homolog:At5g08540
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)5 55.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 44.75cM
M. lewisii x M. cardinalis(2009)2+4 46.30cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTAAGACCGTCCGCAAATTCOvergo seq fw:CGGCTTCTGAAACAGCGTGTAGAC
Reverse primer:TCCCTTCTCGAACAGCTCATOvergo seq rv: GATGCTGAGAAGCTTTGTCTACAC
Tm:Tm:65.40
IM62 length741.6BAC contig(s):MgFPC2768, MlFPC10, MlFPC20, MlFPC48
    
MgSTS10Mimulus unigene:MgU261Phytome id:
 Arabidopsis homolog:At2g33800
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCCCATGACGAAATACAAGOvergo seq fw:TTAGAGCGTTGTTACTGCCTAGCT
Reverse primer:CTGCCCCATAGTCTGCTTCAOvergo seq rv: AACGCCCTCGGAAAACAGCTAGGC
Tm:Tm:65.40
IM62 length852.5BAC contig(s):
    
MgSTS11Mimulus unigene:MgU340Phytome id:mgut1342
 Arabidopsis homolog:At1g06570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 31.10cM
M. guttatus Irn Mtn Combined(2009)13 95.99cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 2.19cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCCAGATTTTCACCAAGCOvergo seq fw:GGAACTTTGCTCCAGATTTTCACC
Reverse primer:ACATCCACCCTTCTGGTACGOvergo seq rv: TATCACCGACGGGCTTGGTGAAAA
Tm:Tm:65.40
IM62 length774BAC contig(s):MlFPC1619, MlFPC21, MlFPC729, MlFPC81
    
MgSTS12Mimulus unigene:MgU382Phytome id:mgut1532
 Arabidopsis homolog:At1g51510
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CGCTTTGACACCCTTGATTCOvergo seq fw:CCTCCTTCTGAAAGGACCTTTGCT
Reverse primer:GCCTCCTCATGAACTCCAGTAOvergo seq rv: CGTTGATTGGGCATTCAGCAAAGG
Tm:Tm:65.40
IM62 length848BAC contig(s):
    
MgSTS13Mimulus unigene:MgU460Phytome id:
 Arabidopsis homolog:At1g04850
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAATCCAGGCGAGGAGAAATOvergo seq fw:AAGCGCAGGAGCACGCGGAGTTAA
Reverse primer:AATCCGCAAAGTTCGAGAAAOvergo seq rv: AAATTGGTGTGTTTGGTTAACTCC
Tm:Tm:65.40
IM62 length618BAC contig(s):
    
MgSTS14Mimulus unigene:MgU464Phytome id:mgut1852
 Arabidopsis homolog:At3g63410
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGAGCCATTGAAGGACTGOvergo seq fw:TACAAACGGGTTCACAGGTTCCGA
Reverse primer:AAGCCTCAGCACCCTGTAAGOvergo seq rv: AAAGGCGGAGGATGTATCGGAACC
Tm:Tm:65.40
IM62 length646BAC contig(s):
    
MgSTS15Mimulus unigene:MgU485Phytome id:
 Arabidopsis homolog:At2g24060
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 51.99cM
M. guttatus IM62_x_DUN RILs(2009)11 35.69cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCGTGTGGATTTGAAGGAGTOvergo seq fw:GGTCCAAGCCACCTGTTGATGAAG
Reverse primer:CGCCGTCTTTCAAGAATCTCOvergo seq rv: GAAGAGATATCTAGGGCTTCATCA
Tm:Tm:65.40
IM62 length556?603?BAC contig(s):MgFPC455, MgFPC468, MgFPC823, MlFPC1246, MlFPC1436, MlFPC448, MlFPC933
    
MgSTS16Mimulus unigene:MgU609Phytome id:mgut2416
 Arabidopsis homolog:At3g23940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)14 7.34cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 10.11cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:
Forward primer:CTGCAATCGAGGGATTTGATOvergo seq fw:ATGTGCTACAGTCTGCAATCGAGG
Reverse primer:GCTCGGTCGATTCAGTCTTCOvergo seq rv: TGTCGGCGATCAAATCCCTCGATT
Tm:Tm:65.40
IM62 length394BAC contig(s):
    
MgSTS17Mimulus unigene:MgU1140Phytome id:mgut525
 Arabidopsis homolog:At5g12290
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 113.40cM
M. guttatus Irn Mtn Combined(2009)14 48.66cM
M. guttatus IM62_x_DUN RILs(2009)14 106.62cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAGGCATGCAAAAGACACTGOvergo seq fw:GCTCCATGCGTGATGCAATACTCA
Reverse primer:GTTTGAAGACCTGGCTTTGCOvergo seq rv: CAAACGGATCACAAGCTGAGTATT
Tm:Tm:65.40
IM62 length217BAC contig(s):
    
MgSTS18Mimulus unigene:MgU772Phytome id:mgut3331
 Arabidopsis homolog:At5g18580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 91.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 80.52cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTTGGCCAAGTATCGATTTOvergo seq fw:AAAAGAGCGCCGAAGCTGGCTCCA
Reverse primer:AGGCAAACCCACATAGCATCOvergo seq rv: TTGTAGAAGCTTGGAATGGAGCCA
Tm:Tm:65.40
IM62 length265BAC contig(s):MgFPC836, MlFPC1192, MlFPC1618
    
MgSTS19Mimulus unigene:MgU140Phytome id:mgut658
 Arabidopsis homolog:At1g60430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 39.90cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 26.78cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATTTGCCGTTCCACAATCTCOvergo seq fw:CGCCACACTCAATAACCTCCCACT
Reverse primer:AGTTCCATTCGACCGATACGOvergo seq rv: GATACGTGAAGAAACGAGTGGGAG
Tm:Tm:65.40
IM62 length334BAC contig(s):MlFPC147, MlFPC55
    
MgSTS20Mimulus unigene:MgU529Phytome id:
 Arabidopsis homolog:At3g56940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 19.10cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 14.58cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACTGGTGCCAAGACGAGAATOvergo seq fw:GGATGCTCAACATCTGGTACCGCT
Reverse primer:ATCCCCTCGTAAAAGGCTGTOvergo seq rv: CTGCAAGAATATTCCCAGCGGTAC
Tm:Tm:65.40
IM62 length275BAC contig(s):
    
MgSTS21Mimulus unigene:MgU551Phytome id:
 Arabidopsis homolog:At2g39730
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 64.60cM
M. guttatus Irn Mtn Combined(2009)6 38.25cM
M. guttatus IM62_x_DUN RILs(2009)6 63.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 60.45cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACTTGTTTTCGCCAAGATGGOvergo seq fw:CCGTTCTCAACTCCTACGACTATA
Reverse primer:GTTGATGAAGAGGCAGCACAOvergo seq rv: TTAAGGCCCTGGCTGATATAGTCG
Tm:Tm:65.40
IM62 length229BAC contig(s):
    
MgSTS22Mimulus unigene:MgU1122Phytome id:mgut510
 Arabidopsis homolog:At2g40090
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 93.50cM
M. guttatus IM62_x_DUN RILs(2009)6 89.95cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 24.77cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGGTGTTCAACCAAGTGATOvergo seq fw:GACTTCATGATCGAGGCCAAGAAC
Reverse primer:CCCATGCTTAAACATCATTTCAOvergo seq rv: CCAAGCACTTTACGCTGTTCTTGG
Tm:Tm:65.40
IM62 length286BAC contig(s):
    
MgSTS23Mimulus unigene:MgU475Phytome id:mgut1903
 Arabidopsis homolog:At3g04240
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)7 2.19cM

Set:B / C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCGTTTAACTTGCCCTCTTOvergo seq fw:CCTGTTTGTAAGGTCTCGGAGCTT
Reverse primer:CTCCATGTCGTTCTCAGCAAOvergo seq rv: GGCACTGAATCCTTCAAAGCTCCG
Tm:Tm:65.40
IM62 length241BAC contig(s):MgFPC12, MgFPC1645, MgFPC183, MgFPC227
    
MgSTS24Mimulus unigene:MgU125Phytome id:mgut587
 Arabidopsis homolog:At2g44160
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 150.80cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 139.17cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGACAAGTTCGTCCAAGTCGOvergo seq fw:GCACTCGACCTGGTCAAGCATATC
Reverse primer:CCCCTCCCTCCTGAATAACAOvergo seq rv: CACCATATTCAGAACGGATATGCT
Tm:Tm:65.40
IM62 length386BAC contig(s):MgFPC581, MlFPC961
    
MgSTS25Mimulus unigene:MgU504Phytome id:
 Arabidopsis homolog:At5g52570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 18.00cM
M. guttatus Irn Mtn Combined(2009)6 35.22cM
M. guttatus IM62_x_DUN RILs(2009)6 10.08cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AATGGAGATGTGGGCAAGATOvergo seq fw:CTTCCCTATCCAGCTCTTCCAACC
Reverse primer:AATTGCGGGAACAGCATTAGOvergo seq rv: CTTGAAGAAGTAGGAGGGTTGGAA
Tm:Tm:65.40
IM62 length291BAC contig(s):MgFPC2983, MgFPC3262, MgFPC66, MlFPC1, MlFPC10, MlFPC1880, MlFPC75
    
MgSTS26Mimulus unigene:MgU229Phytome id:mgut921
 Arabidopsis homolog:At1g20580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 12.40cM
M. guttatus IM62_x_DUN RILs(2009)11 5.18cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 7.19cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATGGAAAGCTCTCGCAACTOvergo seq fw:CCTAGCTTCTAAACGCTTAAACAT
Reverse primer:CGCTTAAACATGGGAGCATTOvergo seq rv: GCTCAAGAATGCTCCCATGTTTAA
Tm:Tm:63.35
IM62 length180BAC contig(s):MgFPC1692, MlFPC184, MlFPC23
    
MgSTS27Mimulus unigene:MgU374Phytome id:mgut1502
 Arabidopsis homolog:At5g20570
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 63.20cM
M. guttatus Irn Mtn Combined(2009)10 54.85cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 87.90cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGGAAGGTGTTCGAGATCAAOvergo seq fw:CCACCTGCTAATACAGTGGAAGTG
Reverse primer:TCCTGCAAATCGCACAATTAOvergo seq rv: TTGCAACCATGCGTTCCACTTCCA
Tm:Tm:65.40
IM62 length195BAC contig(s):MlFPC1124, MlFPC242, MlFPC37, MlFPC50, MlFPC718, MlFPC971
    
MgSTS28Mimulus unigene:MgU836Phytome id:
 Arabidopsis homolog:At5g58330
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 107.60cM
M. guttatus Irn Mtn Combined(2009)6 56.29cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 14.29cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGATTGTTGATGCAATCAGGOvergo seq fw:GGAAGCATTGTATCTCCCGGAAGA
Reverse primer:GCACGGCATACTGAAGACAAOvergo seq rv: GTATCGCTGTGTGTGATCTTCCGG
Tm:Tm:65.40
IM62 length245.6BAC contig(s):MlFPC149, MlFPC1534
    
MgSTS29Mimulus unigene:MgU839Phytome id:mgut3758
 Arabidopsis homolog:At4g29040
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)14 106.60cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGGATCTTGTCGTTTGTTGOvergo seq fw:GTCGTTTGTTGATAAGGATCAACT
Reverse primer:ACAGATACCATGGGGTCCACOvergo seq rv: CGCACATCCAGGCTCGAGTTGATC
Tm:Tm:65.40
IM62 length430BAC contig(s):MgFPC693, MlFPC1197, MlFPC1433, MlFPC1455, MlFPC1913, MlFPC231, MlFPC322, MlFPC542, MlFPC989
    
MgSTS30Mimulus unigene:MgU860Phytome id:mgut3908
 Arabidopsis homolog:At5g63860
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 55.70cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TGGTGTAGGTGACAGCATCGOvergo seq fw:
Reverse primer:TGAGAACACGTTCTGCCTGTOvergo seq rv:
Tm:Tm:
IM62 length233BAC contig(s):
    
MgSTS31Mimulus unigene:MgU886Phytome id:mgut4096
 Arabidopsis homolog:At5g46110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 81.67cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 67.73cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGGTTGGAATGTTTTACCAOvergo seq fw:CCACTCTCTCGAGTGTGTTCGTTG
Reverse primer:CGAAGGCCAAGATTGAGAAGOvergo seq rv: CTCTACAATCAGCTTGCAACGAAC
Tm:Tm:65.40
IM62 length216BAC contig(s):
    
MgSTS32Mimulus unigene:MgU949Phytome id:mgut4543
 Arabidopsis homolog:At1g60000
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACCGGAAAAAGCAGAGGATTOvergo seq fw:CCACAACCGAAGGAGCCACTATAT
Reverse primer:GGCTGTGCCGAGAAAGTAACOvergo seq rv: TGTAGTCCGTTTCCGAATATAGTG
Tm:Tm:65.40
IM62 length244(M13)BAC contig(s):
    
MgSTS33Mimulus unigene:MgU962Phytome id:mgut4637
 Arabidopsis homolog:At5g53180
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGATGGGAAAAAGCTGGACOvergo seq fw:GTCCATCCAAGGCTTGCTTTGAAG
Reverse primer:GAACAGGCCCAAAAGATGAAOvergo seq rv: GCTCAGACTGCTATTGCTTCAAAG
Tm:Tm:65.40
IM62 length218.6(M13)BAC contig(s):
    
MgSTS34Mimulus unigene:MgU963Phytome id:mgut4646
 Arabidopsis homolog:At4g13430
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)7 31.30cM
M. guttatus Irn Mtn Combined(2009)7 21.47cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)7 16.68cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACGAACGAGCAAATCGAAATOvergo seq fw:TTCTGTAATGACACCTCAGCAATC
Reverse primer:CTCCTGGACGACAATGACCTOvergo seq rv: GGAGGGTTTGCGCTCAGATTGCTG
Tm:Tm:65.40
IM62 length249BAC contig(s):MgFPC478, MlFPC172, MlFPC954
    
MgSTS35Mimulus unigene:MgU977Phytome id:mgut4753
 Arabidopsis homolog:At3g21300
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)9 18.70cM
M. guttatus Irn Mtn Combined(2009)9 67.41cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAAATCGGGGAGAATTTTGGOvergo seq fw:GTGAGGAGTGTGCGGAAACATGTC
Reverse primer:CACACGTGGCTGGATTACACOvergo seq rv: AAGCATTCAACCAGTGGACATGTT
Tm:Tm:65.40
IM62 length251BAC contig(s):MgFPC400, MlFPC107, MlFPC1653
    
MgSTS36Mimulus unigene:MgU1001Phytome id:mgut7
 Arabidopsis homolog:At5g06600
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)12 110.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 48.47cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGTGGATGAGAAGGACGTTGOvergo seq fw:GTTAAACGGGTACTCGAAGAACAG
Reverse primer:GGCTTGCGCTTTGTATCTTTOvergo seq rv: CTTCCTCACCACCATACTGTTCTT
Tm:Tm:64.38
IM62 length185BAC contig(s):MgFPC2960, MgFPC366, MlFPC1188, MlFPC145, MlFPC1877, MlFPC289, MlFPC371, MlFPC907
    
MgSTS37Mimulus unigene:MgU1047Phytome id:mgut334
 Arabidopsis homolog:At3g54050
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 79.30cM
M. guttatus Irn Mtn Combined(2009)10 97.95cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 104.32cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGTGTTCAGGGTGCTGTAAOvergo seq fw:CAGGGAGAGGATCAGAAGAAGCTT
Reverse primer:CCGATGCTATGATCCCTGTTOvergo seq rv: CGTTGGAGACAACATCAAGCTTCT
Tm:Tm:65.40
IM62 length434BAC contig(s):MlFPC1049, MlFPC1626, MlFPC1784, MlFPC730
    
MgSTS38Mimulus unigene:MgU1179Phytome id:mgut552
 Arabidopsis homolog:At3g14390
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ATGAGCATGGCATCGACATAOvergo seq fw:
Reverse primer:GTCTCACCGTGTCGGATTTTOvergo seq rv:
Tm:Tm:
IM62 length187BAC contig(s):
    
MgSTS39Mimulus unigene:MgU628Phytome id:mgut2518
 Arabidopsis homolog:At1g72090
Genetic markerPhysical marker
Map:Not MappedSet:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCGGAAGACACTACCAGCAOvergo seq fw:GAGCGTTTCCCGTGATTATCTCAA
Reverse primer:TCGGAAGGATCTCCACAAACOvergo seq rv: GGAAGTGCTGTAGTCCTTGAGATA
Tm:Tm:65.40
IM62 length207BAC contig(s):
    
MgSTS40Mimulus unigene:MgU633Phytome id:mgut2557
 Arabidopsis homolog:At4g31180
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)5 16.40cM
M. guttatus Irn Mtn Combined(2009)5 15.24cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)5 106.08cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGGCAGCTTGTACTGGAAAAOvergo seq fw:AGAATAGCATCACCACTCGCTCCA
Reverse primer:GGGTAGCGGTGAAGGATGTAOvergo seq rv: GGATTTGGAGTGGGATTGGAGCGA
Tm:Tm:65.40
IM62 length144.5BAC contig(s):MgFPC1152, MgFPC159, MgFPC313, MlFPC1438, MlFPC169, MlFPC258, MlFPC454, MlFPC486
    
MgSTS41Mimulus unigene:MgU723Phytome id:mgut3067
 Arabidopsis homolog:At3g59630
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTAGCGGAATTCATCCTCAOvergo seq fw:CGGAATTCATCCTCAGCCATAGCT
Reverse primer:GCAGAGCTTTCACCACCTTCOvergo seq rv: AGAGCTACTCTGGTGAAGCTATGG
Tm:Tm:65.40
IM62 length188.5BAC contig(s):
    
MgSTS42Mimulus unigene:MgU0Phytome id:
 Arabidopsis homolog:At3g23530
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGGCCACTTCATCCAGTCACOvergo seq fw:GGGGGCCATGCTAAAACTGTTACT
Reverse primer:CTTCCGAAGAACACGACCATOvergo seq rv: GAGAAGTGCCATCAACAGTAACAG
Tm:Tm:65.40
IM62 length170BAC contig(s):
    
MgSTS43Mimulus unigene:MgU123Phytome id:mgut578
 Arabidopsis homolog:At2g24270
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 47.50cM
M. guttatus Irn Mtn Combined(2009)10 37.88cM
M. guttatus IM62_x_DUN RILs(2009)10 56.50cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 71.58cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCGGGAAACGATAGAACAAAOvergo seq fw:GCCGATGGAGAGTGGCTTACTTCT
Reverse primer:CAAGGGAGTTCCCTGCAATAOvergo seq rv: CAGATTTGCCAGAAGAAGAAGTAA
Tm:Tm:65.40
IM62 length232BAC contig(s):
    
MgSTS44Mimulus unigene:MgU146Phytome id:
 Arabidopsis homolog:At1g19110
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGATTTTGATCGAAGGGAAAOvergo seq fw:GAAGGCAGCATCATAGTAACCCCT
Reverse primer:CCAAGATTGCGGTCTTGACTOvergo seq rv: GCTTGCACAAATCGGAAGGGGTTA
Tm:Tm:65.40
IM62 length347BAC contig(s):
    
MgSTS45Mimulus unigene:MgU176Phytome id:mgut763
 Arabidopsis homolog:At3g07670
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 30.20cM
M. guttatus Irn Mtn Combined(2009)13 99.33cM
M. guttatus IM62_x_DUN RILs(2009)13 7.08cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTGCTGCTGCATCGAATAAAOvergo seq fw:CAGCGTGCCGCTTCGTATATCTCT
Reverse primer:GTCCAAATCCATCGATCCACOvergo seq rv: ATTGAGGAGGAGATTGAGAGATAT
Tm:Tm:65.40
IM62 length262.7BAC contig(s):MgFPC2651, MgFPC2723, MgFPC2724, MlFPC81
    
MgSTS46Mimulus unigene:MgU212Phytome id:
 Arabidopsis homolog:At3g04240
Genetic markerPhysical marker
Map:Not MappedSet:A
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGTGCTGCAGCTCAATGCTAOvergo seq fw:GGCAACACTATCTGTTACAACAGG
Reverse primer:GCTGGATCGATTCTGAGGACOvergo seq rv: GAAAGGAGCAGCAAGCCCTGTTGT
Tm:Tm:65.40
IM62 length330BAC contig(s):
    
MgSTS47Mimulus unigene:MgU222Phytome id:mgut900
 Arabidopsis homolog:At2g25280
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAGCTTGATGGGTGGCTTAGOvergo seq fw:GTCTCTCATGGATTTGCAGTGGCT
Reverse primer:AATGTTGCCAAAGGCATAGGOvergo seq rv: GCGATACGAACAGTCAAGCCACTG
Tm:Tm:65.40
IM62 length217BAC contig(s):
    
MgSTS48Mimulus unigene:MgU223Phytome id:
 Arabidopsis homolog:At3g53970
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 77.60cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCCTGGAGTACCTGGTTTCGOvergo seq fw:TGAAATCAGCGTCGCCGTGAAAGT
Reverse primer:TGAAAGTGGTGCAAATCTGGOvergo seq rv: CATCCAGATTTGCACCACTTTCAC
Tm:Tm:65.40
IM62 length363BAC contig(s):
    
MgSTS49Mimulus unigene:MgU226Phytome id:
 Arabidopsis homolog:At5g63890
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 73.10cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACATAGCTGCGGATTTGCTTOvergo seq fw:CAGAACCTGCATTCTCAACGAAAC
Reverse primer:CCTCTCCGGCAACTACAAGAOvergo seq rv: GCCGAGAAGTGGGAAAGTTTCGTT
Tm:Tm:65.40
IM62 length366BAC contig(s):
    
MgSTS50Mimulus unigene:MgU231Phytome id:
 Arabidopsis homolog:At2g46280
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 6.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 2.99cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTACGTGACAGAACGTCCAOvergo seq fw:AATGGTGCAACCTCACATATCCAT
Reverse primer:TCCTGACCACCTCCAAGAACOvergo seq rv: TCGAGCGGAGGTGAAGATGGATAT
Tm:Tm:65.40
IM62 length182.7BAC contig(s):MlFPC29, MlFPC662
    
MgSTS51Mimulus unigene:MgU301Phytome id:
 Arabidopsis homolog:At3g55440
Genetic markerPhysical marker
Map:Not MappedSet:C2
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTGATGTTGACGGTTTCCTOvergo seq fw:GTGTCCATGCTTAATGCGGCTGAA
Reverse primer:TCAGCAGCCTTGATGATGTCOvergo seq rv: CATCTTGCGATGGTACTTCAGCCG
Tm:Tm:65.40
IM62 length177BAC contig(s):
    
MgSTS52Mimulus unigene:MgU314Phytome id:
 Arabidopsis homolog:At3g26580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 29.04cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:GATTTGGGGCAGAAAGCATAOvergo seq fw:
Reverse primer:TGCTAGCCTCGTAAGCCATTOvergo seq rv:
Tm:Tm:
IM62 length250BAC contig(s):
    
MgSTS53Mimulus unigene:MgU358Phytome id:
 Arabidopsis homolog:At2g20060
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 5.36cM
M. guttatus IM62_x_DUN RILs(2009)12 0.00cM

Set:C / C2
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATGGCAGCTTGCTAAAAGGOvergo seq fw:CTTCACGTGACATAACGAGCGTAT
Reverse primer:TTTCTACCGGTCCCACTCACOvergo seq rv: AGCATTCTGCTGCACGATACGCTC
Tm:Tm:65.40
IM62 length228BAC contig(s):
    
MgSTS54Mimulus unigene:MgU445Phytome id:
 Arabidopsis homolog:At1g06820
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TCAAATTCGATGTGGGATCAOvergo seq fw:
Reverse primer:AAACCCGACTGCTGCTAATGOvergo seq rv:
Tm:Tm:
IM62 length366BAC contig(s):
    
MgSTS55Mimulus unigene:MgU462Phytome id:
 Arabidopsis homolog:At4g21280
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 93.00cM
M. guttatus Irn Mtn Combined(2009)13 34.83cM
M. guttatus IM62_x_DUN RILs(2009)13 60.72cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 65.61cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTCACTTCCAAGCTCCTCAOvergo seq fw:TTCAGTGTGGACACAGTTTCAGCG
Reverse primer:TGTGGACACAGTTTCAGCGTAOvergo seq rv: AGGCGGAGAAGTACTACGCTGAAA
Tm:Tm:65.40
IM62 length199/213BAC contig(s):MgFPC241, MgFPC2585, MgFPC2768, MgFPC30, MlFPC1223, MlFPC1242, MlFPC494, MlFPC711
    
MgSTS56Mimulus unigene:MgU520Phytome id:
 Arabidopsis homolog:At3g63490
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 82.70cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGACTGATGCCAAACCCTAAOvergo seq fw:ACACCTTTTGCCCCCGATGGCTTG
Reverse primer:AATCTGCCTTCCCAAAAGGTOvergo seq rv: AATCAGTAGACTCGAACAAGCCAT
Tm:Tm:65.40
IM62 length229.7BAC contig(s):
    
MgSTS57Mimulus unigene:MgU94Phytome id:mgut4476
 Arabidopsis homolog:At2g45290
Genetic markerPhysical marker
Map:Not MappedSet:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGTGAACTACCTTCCGGTTGOvergo seq fw:TTGAGGTTTGTCTGGGAGAGGTTT
Reverse primer:TTAGACCGGGGAGAACCTTTOvergo seq rv: CAGGCGATGCAACAAGAAACCTCT
Tm:Tm:65.40
IM62 length231BAC contig(s):
    
MgSTS58Mimulus unigene:MgU768Phytome id:mgut3310
 Arabidopsis homolog:At5g58420
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 77.20cM
M. guttatus Irn Mtn Combined(2009)6 38.54cM
M. guttatus Irn Mtn Combined(2009)10 104.17cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 42.12cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCAATCAGGGATGAGGAAGCOvergo seq fw:CCCTTCTTTCCGAACTGAACTGAG
Reverse primer:ATGGTGTCGTTTGCCTTGATOvergo seq rv: AGCTATGCAAAGTCCGCTCAGTTC
Tm:Tm:65.40
IM62 length242.6BAC contig(s):MgFPC33, MlFPC1224, MlFPC1472, MlFPC152, MlFPC261, MlFPC410, MlFPC696
    
MgSTS59Mimulus unigene:MgU832Phytome id:mgut3701
 Arabidopsis homolog:At5g67030
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 42.10cM
M. guttatus Irn Mtn Combined(2009)8 34.93cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 29.19cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTCCGATTGGAGATTCGACOvergo seq fw:GCGATCGGATTAATGGCTTGCTTG
Reverse primer:ACTCCAGGAACGTTTGGATGOvergo seq rv: TTGCCGGAAATGCCATCAAGCAAG
Tm:Tm:65.40
IM62 length203.5BAC contig(s):MgFPC260, MgFPC394, MgFPC542
    
MgSTS60Mimulus unigene:MgU867Phytome id:mgut3962
 Arabidopsis homolog:At5g47820
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CTCTATGGCCGATGCAAAAAOvergo seq fw:
Reverse primer:CGAGCTCCTTCATCTGCTCTOvergo seq rv:
Tm:Tm:
IM62 length666BAC contig(s):
    
MgSTS61Mimulus unigene:MgU880Phytome id:mgut4060
 Arabidopsis homolog:At1g32900
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 107.58cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GACCCCACGGACGTACTAAAOvergo seq fw:TTTGCAAGCGGAGCAATTTCGTCG
Reverse primer:AGCAGCAGTGATTCCCACTTOvergo seq rv: AACCCGGTATTGAAGGCGACGAAA
Tm:Tm:65.40
IM62 length595BAC contig(s):
    
MgSTS62Mimulus unigene:MgU888Phytome id:mgut4111
 Arabidopsis homolog:At5g62050
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ACGCCTTTGAAGGGACTTCTOvergo seq fw:CGGTGGCTGCTCTCCAGTATTTGA
Reverse primer:GTTTTCCGCCATGTTCCTAAOvergo seq rv: CAATGCACGTAGTCAATCAAATAC
Tm:Tm:65.40
IM62 length183BAC contig(s):
    
MgSTS63Mimulus unigene:MgU890Phytome id:mgut4122
 Arabidopsis homolog:At5g13260
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 1.82cM
M. guttatus IM62_x_DUN RILs(2009)11 75.02cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 59.34cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AACCATCCGCAAAGGAGTAAOvergo seq fw:GGGAAGCTTCCCAAAGCCGTTGCT
Reverse primer:TTTGGACGTCTTTGTTGAGCOvergo seq rv: AGGAAATTGGGAATCAAGCAACGG
Tm:Tm:65.40
IM62 length536.5BAC contig(s):
    
MgSTS64Mimulus unigene:MgU902Phytome id:mgut4204
 Arabidopsis homolog:At5g18200
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 78.67cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGGGTTCACCTGACTGATCTOvergo seq fw:CGGCTCGTTCAACTGCAAACACAT
Reverse primer:CTGTGCGAGTGGCTCATAGAOvergo seq rv: ACTTACGCTTGCGAAGATGTGTTT
Tm:Tm:65.40
IM62 length828BAC contig(s):MlFPC159, MlFPC1640, MlFPC713, MlFPC805
    
MgSTS65Mimulus unigene:MgU910Phytome id:mgut4269
 Arabidopsis homolog:At2g17420
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCCATTACTGCAGCTGGAACOvergo seq fw:CCGATCTCTTGAAGGTAATGTTCT
Reverse primer:GCATCTAATGCCGCCATACOvergo seq rv: TGGCGGCATTAGATGCAGAACATT
Tm:Tm:64.38
IM62 length>1000BAC contig(s):
    
MgSTS66Mimulus unigene:MgU917Phytome id:mgut4317
 Arabidopsis homolog:At5g63910
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:ATCAATACCCCGGAGAGAGCOvergo seq fw:
Reverse primer:AGAACGGTGCATCATCGAATOvergo seq rv:
Tm:Tm:
IM62 lengthBAC contig(s):
    
MgSTS67Mimulus unigene:MgU926Phytome id:mgut4376
 Arabidopsis homolog:At2g04030
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGTGTTTCTCCGGGAGCTTOvergo seq fw:AGCTTTTCGAGGAGTGGATTGGAG
Reverse primer:GCTAGCTCACCAGCATCTCCOvergo seq rv: TCCTCTCCAGTTTCCACTCCAATC
Tm:Tm:65.40
IM62 length222BAC contig(s):
    
MgSTS68Mimulus unigene:MgU927Phytome id:mgut4384
 Arabidopsis homolog:At5g44520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 137.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 104.31cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGTGCAACTGAAGCAGCAAAOvergo seq fw:TCGACGAATCCAACCTACTCCTCC
Reverse primer:CTACAACATCCGCATCATCGOvergo seq rv: GTGTATTTAGCGGCTTGGAGGAGT
Tm:Tm:65.40
IM62 length357BAC contig(s):
    
MgSTS69Mimulus unigene:MgU967Phytome id:mgut4683
 Arabidopsis homolog:At3g29320
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 15.32cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GAGGAAGTGGGAGACGACAAOvergo seq fw:CGAATAGTTCTGTCACTGCTGAAC
Reverse primer:CCTTCCAACGATCCAATCATOvergo seq rv: CAGCAGGTTCCTACAAGTTCAGCA
Tm:Tm:64.38
IM62 length306.6BAC contig(s):MlFPC337, MlFPC842
    
MgSTS70Mimulus unigene:MgU968Phytome id:mgut4688
 Arabidopsis homolog:At2g41700
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 17.20cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTGCTGATGTTTTCGGACAOvergo seq fw:CGAGTGTCGATTGGCTGATGCTAT
Reverse primer:GAATTCGTTGCGAAATGGTTOvergo seq rv: CTTGGAATATCAGAGTATAGCATC
Tm:Tm:63.35
IM62 length201BAC contig(s):MgFPC2932, MlFPC1552, MlFPC157, MlFPC189, MlFPC337, MlFPC384, MlFPC406, MlFPC470, MlFPC527, MlFPC560, MlFPC579, MlFPC615, MlFPC840
    
MgSTS71Mimulus unigene:MgU970Phytome id:mgut4703
 Arabidopsis homolog:At5g66120
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATTTTGCCAGATGGAGAGCOvergo seq fw:CCTTTCAAGAGTATCAGCCGTAGG
Reverse primer:CACATGTCACCGATGACTCCOvergo seq rv: AGGTTGCAGACGGTTTCCTACGGC
Tm:Tm:65.40
IM62 length229BAC contig(s):
    
MgSTS72Mimulus unigene:MgU971Phytome id:
 Arabidopsis homolog:At5g24300
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:ATGCGATACGGCACTATTCCOvergo seq fw:CCCATGATGGCTTGTGCTCTTTGT
Reverse primer:AGTCCCTTCACCGCTACCTTOvergo seq rv: ATAGCCGTCGGAACATACAAAGAG
Tm:Tm:65.40
IM62 length206BAC contig(s):
    
MgSTS73Mimulus unigene:MgU1016Phytome id:mgut124
 Arabidopsis homolog:At5g61150
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 51.47cM
M. guttatus Irn Mtn Combined(2009)7 13.92cM

Set:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTTTCGTCAGGCATGGAAAGOvergo seq fw:CCTACGGATGGGTTGCGTATATTT
Reverse primer:AATTCGACCCTGAGATTGGAOvergo seq rv: GGAGAAGGTAACCCGTAAATATAC
Tm:Tm:65.40
IM62 length250BAC contig(s):
    
MgSTS74Mimulus unigene:MgU1097Phytome id:
 Arabidopsis homolog:At1g08410
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGCAGATCTCCTCCCATTOvergo seq fw:GACTGCAGACGAGCAAGTAGCTCA
Reverse primer:AGCAGACTTTGCTGACCAGAOvergo seq rv: AACTATATGGCAGGGATGAGCTAC
Tm:Tm:65.40
IM62 length183BAC contig(s):
    
MgSTS75Mimulus unigene:MgU1116Phytome id:
 Arabidopsis homolog:At2g41530
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 13.70cM
M. guttatus IM62_x_DUN RILs(2009)10 95.48cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 29.32cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGACATGTAGCGCTCGTAATOvergo seq fw:CGAGTGATCGTAACCCGCTTGCAT
Reverse primer:ATAGGTGCAAAAGCCGACACOvergo seq rv: TCCTCTGTTACTCAGAATGCAAGC
Tm:Tm:65.40
IM62 length177BAC contig(s):
    
MgSTS76Mimulus unigene:MgU1118Phytome id:mgut506
 Arabidopsis homolog:At4g15560
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 83.70cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATTTCCCGATCGTTGCTTOvergo seq fw:ATTCATATCGTCACCGAAAAAGGC
Reverse primer:AAGATCCACATCATGCACCAOvergo seq rv: CCGGAGGGTAGCCTTTGCCTTTTT
Tm:Tm:65.40
IM62 length259BAC contig(s):MgFPC2041, MgFPC273, MgFPC2779, MgFPC3005, MgFPC414, MgFPC604, MlFPC1205, MlFPC464, MlFPC472, MlFPC545, MlFPC680, MlFPC995
    
MgSTS77Mimulus unigene:MgU1148Phytome id:
 Arabidopsis homolog:At2g29980
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CATCACGGTCACGAGAAGAAOvergo seq fw:AGGGTAGCTTCTTCTCGTGACCGT
Reverse primer:CTGAGGGAAGAGGTGGTGAAOvergo seq rv: ACATATCTGCACCATCACGGTCAC
Tm:Tm:65.40
IM62 length"369?,377?"BAC contig(s):
    
MgSTS78Mimulus unigene:MgU1174Phytome id:mgut548
 Arabidopsis homolog:At3g46780
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCGATTGGCTGTCAATTAOvergo seq fw:TTTCCGCCGCCCAGGAATTAGCTC
Reverse primer:ATGGCTCTGGCAATTGATTCOvergo seq rv: TAATTGACAGCCAATCGAGCTAAT
Tm:Tm:65.40
IM62 length102BAC contig(s):
    
MgSTS79Mimulus unigene:MgU1190Phytome id:mgut560
 Arabidopsis homolog:At3g16630
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GATCTTTTGAGCGACAGGAAGOvergo seq fw:GCAGCAGAAGACCTCGTTAGATTG
Reverse primer:TGTTGTCTACCATCTTCTCTCATACAOvergo seq rv: AAACTGGCTGATGCAGCAATCTAA
Tm:Tm:65.40
IM62 length234.5BAC contig(s):
    
MgSTS80Mimulus unigene:MgU581Phytome id:mgut2347
 Arabidopsis homolog:At5g23050
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AAGGAGCTACGCTCGTCAGTOvergo seq fw:GCTGTGATATGGCGCGATGAAGGA
Reverse primer:CAATTGCAGAGCCTTTCTCCOvergo seq rv: CTGGATTTTCATCATCTCCTTCAT
Tm:Tm:64.38
IM62 length206BAC contig(s):
    
MgSTS81Mimulus unigene:MgU610Phytome id:mgut2420
 Arabidopsis homolog:At4g02460
Genetic markerPhysical marker
Map:Not MappedSet:D / D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGCTGCTACCAGTGAGTTGGOvergo seq fw:GCTGTCAAGACTCCGGTGCATGAA
Reverse primer:TTCCCGATAATGAAGCCAAGOvergo seq rv: TCTTCCAGAAGCATGATTCATGCA
Tm:Tm:65.40
IM62 length355BAC contig(s):
    
MgSTS82Mimulus unigene:MgU645Phytome id:mgut2617
 Arabidopsis homolog:At5g13630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)10 93.62cM

Set:
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:ACAAATCTCGTGCAGGGTCTOvergo seq fw:
Reverse primer:ACGGTTTCCGAAAGTGTACGOvergo seq rv:
Tm:Tm:
IM62 length472BAC contig(s):
    
MgSTS83Mimulus unigene:MgU658Phytome id:mgut2692
 Arabidopsis homolog:At1g21750
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:CAGCTTTACAAGGGCCAAGAOvergo seq fw:GAATACAAAGGACCACGAGAGGCA
Reverse primer:GTTCATCCTTGAGCCCAAAATAOvergo seq rv: AGGTCACAATGCCATCTGCCTCTC
Tm:Tm:65.40
IM62 length172BAC contig(s):
    
MgSTS84Mimulus unigene:MgU667Phytome id:mgut2749
 Arabidopsis homolog:At2g23460
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 30.35cM
M. guttatus IM62_x_DUN RILs(2009)8 8.21cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 24.55cM

Set:B / C
Guttatus map status:polymorphic by sizePhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCACCGAAGAAGTTGAAACCOvergo seq fw:CAAAGCTGCCCTAATCCACCGAAG
Reverse primer:GCCTTAATAGGACCCCCAACOvergo seq rv: TTCCCGGTTTCAACTTCTTCGGTG
Tm:Tm:65.40
IM62 length237BAC contig(s):MlFPC1, MlFPC672, MlFPC777
    
MgSTS85Mimulus unigene:MgU672Phytome id:mgut2782
 Arabidopsis homolog:At5g13630
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)10 91.47cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 27.39cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TGGGGTAAACTGAGGAGGAAOvergo seq fw:CGGATACTATTGGCCGAGTTAACC
Reverse primer:GCGAAGACGTTTAGGTACGCOvergo seq rv: CTCACAATCTCAACCGGGTTAACT
Tm:Tm:65.40
IM62 length711.5BAC contig(s):MgFPC2800, MgFPC2932
    
MgSTS86Mimulus unigene:MgU680Phytome id:mgut2827
 Arabidopsis homolog:At4g22220
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGGAGAGCGGGAAGATTGTTOvergo seq fw:ATTGTTGATGCTTGTTTCAAGACC
Reverse primer:GTCTACCCTTCACCCATTCGOvergo seq rv: CGGAACCGCAGCCGAAGGTCTTGA
Tm:Tm:65.40
IM62 length>1000BAC contig(s):
    
MgSTS87Mimulus unigene:MgU684Phytome id:mgut2847
 Arabidopsis homolog:At5g17230
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 69.10cM
M. guttatus Irn Mtn Combined(2009)11 0.00cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTTCGACGATGCAGAGAGTGOvergo seq fw:GCATATGCAAGCGGCAGAGCAAGA
Reverse primer:ACATAAGCCCTCCTCGTGAAOvergo seq rv: GCAAACCGAAGAAGATTCTTGCTC
Tm:Tm:65.40
IM62 length311BAC contig(s):MgFPC570, MgFPC814, MlFPC1088, MlFPC132, MlFPC237, MlFPC743
    
MgSTS88Mimulus unigene:MgU686Phytome id:mgut2858
 Arabidopsis homolog:At1g65660
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:
Forward primer:ACCACTTATCAGGCGGTGAAOvergo seq fw:ATATGTCCTCTGCGCCTTGGTACT
Reverse primer:CCTTTCCAAGCATGACTTCCOvergo seq rv: GGTCTCTCTGCATTCAAGTACCAA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS89Mimulus unigene:MgU695Phytome id:mgut2910
 Arabidopsis homolog:At5g65280
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in any genotypes testedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:AGAGCTGGCGCTTCTGTAAAOvergo seq fw:AAAATGAAGCAAGACGTGTAAAAT
Reverse primer:GCAGTGGAAAATGAAGCAAGAOvergo seq rv: CCACGGCCTTGCCGGCATTTTACA
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS90Mimulus unigene:MgU721Phytome id:mgut3056
 Arabidopsis homolog:At5g65280
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:
Forward primer:TACTGTGGGGATCAAACGAAOvergo seq fw:GCTGATGCTTTTCTAAGAGCCGCC
Reverse primer:CTGGGAGAGCTTTCTCTCGTOvergo seq rv: GATCTTTGAGGGAGATGGCGGCTC
Tm:Tm:65.40
IM62 length644BAC contig(s):
    
MgSTS91Mimulus unigene:MgU119Phytome id:mgut559
 Arabidopsis homolog:At3g56940
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 17.80cM
M. guttatus IM62_x_DUN RILs(2009)11 11.82cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 15.11cM

Set:A / D2
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CTCATGTCCAGAGACGAAGCOvergo seq fw:CTGGGTTTCTTCTCTACAAGGAGC
Reverse primer:AGGAATCCCAAATCGAGAGCOvergo seq rv: TTGAGCCTCCTACCAAGCTCCTTG
Tm:Tm:65.40
IM62 length178.8BAC contig(s):MgFPC684, MlFPC109, MlFPC1441, MlFPC769
    
MgSTS92Mimulus unigene:MgU128Phytome id:
 Arabidopsis homolog:At3g60320
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 85.57cM
M. guttatus IM62_x_DUN RILs(2009)2 77.27cM

Set:D2
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CAGCTCGTCGAACTTTGTCAOvergo seq fw:GACTAGGCCTCGGACTTGTTGGAC
Reverse primer:TTGGTTCATCGATCTCCACAOvergo seq rv: AGTCCAAAACGACATAGTCCAACA
Tm:Tm:65.40
IM62 length423?BAC contig(s):
    
MgSTS93Mimulus unigene:MgU132Phytome id:mgut607
 Arabidopsis homolog:At1g20580
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)11 12.00cM
M. guttatus IM62_x_DUN RILs(2009)11 2.88cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 6.61cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTCAAGAATGCTCCCATGTOvergo seq fw:GCCCCTGATGAAAACATGCTCTAG
Reverse primer:CACGTCCAACACCAAGTGACOvergo seq rv: TGGAAAGCTCTCACAACTAGAGCA
Tm:Tm:64.38
IM62 length176BAC contig(s):MgFPC1521, MgFPC1692, MgFPC2534, MgFPC981, MlFPC1, MlFPC109, MlFPC184, MlFPC746, MlFPC931
    
MgSTS94Mimulus unigene:MgU133Phytome id:
 Arabidopsis homolog:At3g04400
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 103.67cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 16.84cM

Set:B / C
Guttatus map status:genotyped by size (map position yet to be determined)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GCTGGGGTTATTGTGAATCCOvergo seq fw:ATCAGCACACTCCTTTCCAATAGG
Reverse primer:TAGGCCACAAATCAGCACACOvergo seq rv: ATCTGCCATCACCGGTCCTATTGG
Tm:Tm:65.40
IM62 length197BAC contig(s):MgFPC1765, MgFPC2307, MgFPC251, MgFPC2857, MgFPC2858, MgFPC3005, MgFPC3118
    
MgSTS95Mimulus unigene:MgU141Phytome id:
 Arabidopsis homolog:At5g38520
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 9.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 5.26cM

Set:A / 3x3x3
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TTGGGGAACTCTGTCGGTAGOvergo seq fw:AAACAAATGCATCCAGTGCCCCTT
Reverse primer:GCCACCAGAACAATTGAACAOvergo seq rv: AAACCGGCACTGGATGAAGGGGCA
Tm:Tm:65.40
IM62 length193BAC contig(s):MgFPC2721, MlFPC1162, MlFPC609
    
MgSTS96Mimulus unigene:MgU147Phytome id:mgut686
 Arabidopsis homolog:At5g55860
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CCTGCCATTAGGAAGCAAAAOvergo seq fw:TTTCTGGGCTAAGTGAAGCTCTGT
Reverse primer:AGCTCCGAAAGAGCTTGAGAOvergo seq rv: CGTGCTGGCAAAAGAGACAGAGCT
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS97Mimulus unigene:MgU150Phytome id:
 Arabidopsis homolog:At1g80600
Genetic markerPhysical marker
Map:Not MappedSet:D2
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:GGATCTCCTCTTGTATTCGATGAOvergo seq fw:TATCGGGGTATACTCTGTATGCTT
Reverse primer:CACCGTCATTATATCGGGGTAOvergo seq rv: TACCTATGGGCCCACGAAGCATAC
Tm:Tm:65.40
IM62 lengthBAC contig(s):
    
MgSTS98Mimulus unigene:MgU163Phytome id:
 Arabidopsis homolog:At4g33110
Genetic markerPhysical marker
Map:
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)1 5.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)1 4.70cM

Set:A
Guttatus map status:map position determinedPhys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:TCGGACGGTCTTCTGTTCATOvergo seq fw:GGTCCACTTGACAGCTGAATCTTT
Reverse primer:GTGATCCAATCGTCCTCGTTOvergo seq rv: GGAGTCCACTTATGGTAAAGATTC
Tm:Tm:64.38
IM62 length183BAC contig(s):MgFPC345, MlFPC1890, MlFPC747, MlFPC781, MlFPC935
    
MgSTS99Mimulus unigene:MgU16Phytome id:mgut719
 Arabidopsis homolog:At3g08580
Genetic markerPhysical marker
Map:Not MappedSet:
Guttatus map status:did not amplify in IM62 but did amplify in at least one other genotype (possible PCR error in IM62))Phys map status:
Forward primer:GAGAGGACACACCGGTTACGOvergo seq fw:
Reverse primer:ACCATTCCAGTAAGCCATCGOvergo seq rv:
Tm:Tm:
IM62 lengthBAC contig(s):
    
MgSTS100Mimulus unigene:MgU175Phytome id:mgut762
 Arabidopsis homolog:At5g27710
Genetic markerPhysical marker
Map:Not MappedSet:D
Guttatus map status:amplified in IM62 (the source genotype for the EST sequence)Phys map status:hybridized, one or more BAC matches found in guttatus only
Forward primer:CGAGCTCACCAGAACTCCTTOvergo seq fw:CCGGCACTTGAGCTCCGACATTGA
Reverse primer:AAATCGTAGCGGCTGAGAGAOvergo seq rv: GTCGATGTTAACTATCTCAATGTC
Tm:Tm:65.40
IM62 length133BAC contig(s):