AA100 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 63.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA118C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 5 |
| Position: | 0.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA137 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 14 |
| Position: | 44.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA153C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 69.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA163 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 5 |
| Position: | 47.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA167 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 20.3 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA173C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 1 |
| Position: | 20.9 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA246 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 8 |
| Position: | 123.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA268 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 5 |
| Position: | 65.4 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA277 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 6 |
| Position: | 37.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA280 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 7 |
| Position: | 54.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA296C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 12 |
| Position: | 27.3 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA346C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 4 |
| Position: | 88.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA361 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 7 |
| Position: | 44.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA371C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 6 |
| Position: | 111.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA374C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 4 |
| Position: | 33.3 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA404 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 3 |
| Position: | 5.3 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA420 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 2 |
| Position: | 10.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA454C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 5 |
| Position: | 55.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA66 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 4 |
| Position: | 49.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AA95 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 31.4 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT211 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 8 |
| Position: | 52.2 cM | Show in MapViewer |
| Forward primer: | GATCGGAGAAAGGTTAATCAAC |
| Reverse primer: | ATATCAAACCACATATTTACTGACC |
| Genbank id: | AF012633 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT217 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 8 |
| Position: | 107.5 cM | Show in MapViewer |
| Forward primer: | CCACAGAGAGGATTGGGTGT |
| Reverse primer: | GCATTGAGCAGCTAAAAATGG |
| Genbank id: | G67645 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT222 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | ACGGTAAAAAATGTGCCTGA |
| Reverse primer: | GGAGACGAGGGGTTTTACAG |
| Genbank id: | AF012634 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT225 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 1 |
| Position: | 78.1 cM | Show in MapViewer |
| Forward primer: | ATTCCGACTGGTTTCATTCA |
| Reverse primer: | CTTCCGACTAATCAGTAGAACAACA |
| Genbank id: | AF012635 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT230 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | AATTTCACGTGCCAATCTGA |
| Reverse primer: | CCCTGGGTTAGCACTTAGCA |
| Genbank id: | AF012636 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT233 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | GAGCTGCAATAAATTTTTCGAG |
| Reverse primer: | CCAGCCCACTTGATACACAA |
| Genbank id: | AF012637 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT240 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 13 |
| Position: | 32.9 cM | Show in MapViewer |
| Forward primer: | CCCCTTTTAACCACTATATAATAACC |
| Reverse primer: | AGTGTGTGGGATTGAAAAGAA |
| Genbank id: | G67646 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT242 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | CAATGATGAATTAAATATCTCAAATC |
| Reverse primer: | TTGCAAATTAAACCACAGGA |
| Genbank id: | AF012638 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT249 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | AAGGTCAAAGTGGACCTCGA |
| Reverse primer: | CCAGCATACGACACAGAAAAC |
| Genbank id: | AF012639 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT257 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | ATTAATAATCAACTGGGACATATG |
| Reverse primer: | GTGTTTTAAGGGTTGACATTTAA |
| Genbank id: | AF012640 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT261 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 7 |
| Position: | 16.3 cM | Show in MapViewer |
| Forward primer: | CTCAAGCATCTGCTACGCG |
| Reverse primer: | TTCAGTGCTTTATTTAATCTTGG |
| Genbank id: | G67647 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT265 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | CCCCATAATAAAAGCCCGCT |
| Reverse primer: | GATAATCGCGTCGGGGAAC |
| Genbank id: | G67648 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT267 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 1 |
| Position: | 33.9 cM | Show in MapViewer |
| Forward primer: | ATCCAATTCTTTGGAATAACATC |
| Reverse primer: | TCACTTCATTACAAGTGACCTAGC |
| Genbank id: | AF012641 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT272 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | ACTTGGGTTCAACAATGCAG |
| Reverse primer: | CGTCAAAGCCCTAAAGCTGT |
| Genbank id: | G67649 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT274 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | TGGTAATCCACAGATGACCA |
| Reverse primer: | TTTATGTGTTTGGCAATTGC |
| Genbank id: | AF012642 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT278 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | TGAGACTGTTTGGTGTGCAG |
| Reverse primer: | GGAAGAAGACGATAGGGCTG |
| Genbank id: | AF012643 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT283 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 125.8 cM | Show in MapViewer |
| Forward primer: | GGTGGTGACGGCTAGGTTAA |
| Reverse primer: | GGCGGGTATGGAGATTCTTT |
| Genbank id: | AF012644 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT296 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | TCGGAGAAAGGTTAATCAACG |
| Reverse primer: | TCTACTTCCCAGTCCCAACA |
| Genbank id: | AF012645 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT300 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 6 |
| Position: | 70.2 cM | Show in MapViewer |
| Forward primer: | CCGTTTAGGTTGAGGCGC |
| Reverse primer: | CCGGTTAAAGCTGGCTCATA |
| Genbank id: | AF012646 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT308 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 12 |
| Position: | 58.7 cM | Show in MapViewer |
| Forward primer: | TTACACGGTCGTCAAAGTGG |
| Reverse primer: | TGAATTCCCATCACGTAAACC |
| Genbank id: | AF012647 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT312 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | GATACATGTTGCACGTTGTTCAT |
| Reverse primer: | GGGACGACCATTTGTTCCTA |
| Genbank id: | AF012648 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT333 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | TGATTTTTCAACAACATGCC |
| Reverse primer: | CTCATTCCATTGTCACTCTCA |
| Genbank id: | G67965 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT350 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | ACAAATTGCAGAATATGCGA |
| Reverse primer: | TCTTACAAAATATTGCGATGGA |
| Genbank id: | G67966 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT356 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 11 |
| Position: | 21.9 cM | Show in MapViewer |
| Forward primer: | CAGCAACGGCCTCACTAATG |
| Reverse primer: | GGCGGAACCAGAATTTTATG |
| Genbank id: | AF012649 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT363 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | CCGGGCAAGAGACGGGTAT |
| Reverse primer: | AGAAAAGAATGCAATTCTCACG |
| Genbank id: | AF012650 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT364 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 12 |
| Position: | 67.2 cM | Show in MapViewer |
| Forward primer: | TTGCAATCTGATTTGCTATG |
| Reverse primer: | TGTGAATTTTCATTCGACGC |
| Genbank id: | G67650 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT367 |
Locustype |
| Map: | |
| Linkage group: | 0 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | ATTGCCCAAGTCTTTACTCG |
| Reverse primer: | ACTTTGACTTTTTGACCCTAGC |
| Genbank id: | G67651 | Show genbank entry |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
AAT372 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 0.0 cM | Show in MapViewer |
| Forward primer: | TTAGTCCTCCTCAAGGCAGC |
| Reverse primer: | GATCCGGACGTCATTAATATATTG |
| Genbank id: | G67652 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT374 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 48.4 cM | Show in MapViewer |
| Forward primer: | ATTCCGTTGCTGTCGGATCA |
| Reverse primer: | ACTGAAGCTTATTCGCGCCA |
| Genbank id: | AF012651 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
AAT39 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 8 |
| Position: | 49.8 cM | Show in MapViewer |
| Forward primer: | ACAAGTACCAGAATACTGTCCGG |
| Reverse primer: | AGTTGGTTCATCGGTAACGG |
| Genbank id: | G67654 | Show genbank entry |
| Reference: | Kelly, A. J. and J. H. Willis, Polymorphic microsatellite loci in Mimulus guttatus and related species, Molecular Ecology, vol. 7 (1998), pp. 769-774
show abstract |
| |
B182 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 12 |
| Position: | 0.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA113 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 4 |
| Position: | 90.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA117 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 6 |
| Position: | 24.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA125 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 2 |
| Position: | 0.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA145 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 13 |
| Position: | 20.4 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA153 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 1 |
| Position: | 12.2 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA158 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 8 |
| Position: | 148.8 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA172 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 2 |
| Position: | 52.9 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA175 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 12 |
| Position: | 78.1 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA196 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 11 |
| Position: | 15.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA210 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 4 |
| Position: | 15.1 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA220 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 7 |
| Position: | 60.5 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA222 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 6 |
| Position: | 68.9 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA245C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 12 |
| Position: | 81.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA279C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 4 |
| Position: | 83.5 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA311 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 36.1 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA334 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 13 |
| Position: | 123.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA372 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 8 |
| Position: | 0.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA374 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 1 |
| Position: | 64.4 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA384 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 3 |
| Position: | 11.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA387 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 11 |
| Position: | 56.3 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA396C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 59.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA400 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 22.9 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA416 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 1 |
| Position: | 53.2 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA445 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 9 |
| Position: | 5.5 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA497 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 23.4 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA69 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 5 |
| Position: | 95.7 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BA75 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 3 |
| Position: | 13.2 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BB102 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 7 |
| Position: | 0.0 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BB103C |
Locustype |
| Map: | F2N1 |
| Linkage group: | 7 |
| Position: | 42.6 cM | Show in MapViewer |
Marker |
| Type: | AFLP(CO) |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BB122 |
Locustype |
| Map: | F2N1 |
| Linkage group: | 10 |
| Position: | 50.5 cM | Show in MapViewer |
Marker |
| Type: | AFLP |
| Reference: | L Fishman, AJ Kelly, E Morgan, JH Wills (2001). A Genetic Map in the Mimulus guttatus Species Complex Reveals Transmission Ratio Distortion due to Heterospecific Interactions. Genetics 159, p.1701-1716.
show abstract |
| |
BB124 |
Locustype |
| Map: | F2N1 |
|