MlSTS5072

Genetic marker
Map(s): Not Mapped
Forward primer: GCAGCAGTTCCAAAAACACC
Reverse primer: AGACACCTGCTTTAGCTGTGC
Tm: 60.7
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU520 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 224-322 bp
ACTAGTCCAGAATTTTCTCACCGGTGGCAAAGAGGTTCCACACTAATGTTCCGACGATGTA
CAAAACAACAGCCACTTTGAATACGTCGTCCCAAGAACC

>Exon-2 323-407 bp
CCTTTTGGAGTATGTATCCAGTAGCAGCAGTTCCAAAAACACCAGCAAGTACACCAGCA
GTATTAGATAGTCCCAACAATACTCCA

>Exon-3 408-473 bp
AGCATAACGTGGGCCAATATCTTGGTGATTGGAGTATAGTCCAGACTGCGAGAATGCGTCC
AATCCC

>Exon-4 474-575 bp
CTGACTGCACGACATGCATAGCACAGCTAAAGCAGGTGTCTTCACTTTGCTCAGTTGCG
ATAGGAAGAAAGCTGGGCCTAAAAATCCAATCGACTGCATTATC

>Exon-5 576-713 bp
CTTCCGAACTGTTGTGATTGAAAGACCTCTGCTAATGAGTGTATCAGCAATCCAACCACCT
ATATTGGCAAATACGGCCATCGTGAGCCATGGAAGCACACAAAGCAGTCCAGATTCAGTG
AGGTTGAACTTCAAAACC

>Exon-6 714-923 bp
CTGGTTATAGTAAGTAGGCATCCATGTCAAAAGAATAAACGTTCCCCAATTATGGCAGAAA
TGGGAAATGATGAGAGCCCAGACAGGAGCCTTTGATAGAATTTTCTTCCATGGAATCTTG
GTGACGGGTTCCTTCGATACGCTTCCTCCCAAGATCAGTTCCTTTTCCTCCAGACTCAAT
TTTGGGTCGTCTTTTGGTGAGCTATGTGCT

>Exon-7 924-1139 bp
TTTACTCAACCAAATTGCAAACCAAATACTTCCTAGGGATCCAAAAGAATAGAAAACAGAT
GGCCATCCGAATTTGTGGATCAGTATAGGTGAGAATGCCAAACCAGTAACTGATCCAAGA
TACATTCCGCTGTATACTAGCGCAAGAGATCTGCTTCTCTCCGAGACAGGAATCCATTTT
GATAGCAGATTATTCATAGCAGGCATAGCAACACCC

>Exon-8 1140-1150 bp
CTCGCCAATTCC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: