MlSTS5070

Genetic marker
Map(s): Not Mapped
Forward primer: TACGAGAGCCACAATGATCG
Reverse primer: GTGAGAAGGGCAGAGTTTCG
Tm: 59.8
Physical marker
Overgo sequence fw: CGCCATCGATGCATATCCCATTGT
                ||||||||
Overgo sequence rv:                 GGGTAACACGTGTGCTCTTTCGTT
Tm: 65.4
Set: E
Pools: 1,9,12
View Map
Sequence
Unigene: MlU506 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 39-543 bp
GTTCATAAATCTCCTGCAAAGCTGTGTAAGTACCTATGACAAGAACAATAACACCAATCAA
TACAATTCCCCACAATGCAATCGATTCGAGCCCAAATCTTCGGTAAGATCCCGAGATCTT
CAAGAAGCACAGACACGGGAGAATAATCGAAGCTGTCACGCTCAAGAAAGCACCAACAAG
TGACATTAGATATTCGAAGAAGGGTATTACGAGAGCCACAATGATCGAGCTTAATACC
AAGCCAGTCCTAATCAACGTGCTCAGTCCTTTTTTAGGGTGCGATATGAAACGGTTCTCG
AGAGCACTCACTATTGGAGTCACCATCAACGCATATTTAGCTAACGGATTGACGAGGGCA
GTGTAAATAGCAACTTTCGAGCTGATTTTATCGGTCGGGAGATTTAGGGTTATTTGAGAC
TCCACTTCAGAACCAAACATGAGATACCCTAAAACCGCCATCGATGCATATCCCATTGT
GCACACGAGAAAGCAA
ACAAGCAACACC

>Exon-2 544-800 bp
CTTGGAGAATTTCTTTTGGTTCCTCATCGAAGTGTACAATGTGGGGAAAACTGGATGAGCA
CAATAACAAAAGGCATAGAGGCTAATAGCAGTGGGAATTCCTCTGTAGTTCGAAACTCT
GCCCTTCTCAC
GAAATCCAATTCCGTCGAATGCACCGGCCCACGAAATCGAGCCGATGA
GTACGAAAGAAGCTACAACTCCGGTGGCAGAGATGTAAGAAAGAATGCTCATATTATTCA
ACAAAACACTAGGCAGCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: