MlSTS5068

Genetic marker
Map(s): Not Mapped
Forward primer: ATCAAGCCAATCCAACAAGC
Reverse primer: GAGGATTGAACGGAGTAGGC
Tm: 60.1
Physical marker
Overgo sequence fw: ATCTATCATGGACGATGTGCCTAC
                ||||||||
Overgo sequence rv:                 CACGGATGAGGCAAGTTAGGAGGG
Tm: 65.4
Set: F
Pools: 1,8,13
View Map
Sequence
Unigene: MlU488 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 223-379 bp
ATCAAGCCAATCCAACAAGCTTCTCACTTACCTCCCAAAGTTTACGCGCTTTCTCTGCAT
CACTCGCTTCTTTCGAGAGCTGGTTCTCGAATGAGGACGAGTTGTTGTTCCAGCTCCAGT
ACACCCCCGATTTCGACAGGCTTGGATCACTTATTACC

>Exon-2 380-675 bp
CTGAGCAAGTCTTTTTCCTGCTTCCTCTTCGGAAACGTAGCCTTTGGTGATATACTTCTGG
AAAGGTGGGAAGAGAATTCTGAACAAGGGAATGTGCTCTCTGAATAGTCCAGTTTCGGCA
ATACAACCAGGGTAGAGGGAAGCAAAGGCGATCCCCGTTTCTTCGTGGTAGCGTCTGTGG
AATTCTTGCATAGTGAGCATATTGCAGACTTTGCTATCTTTATAAGCCTTTGCACCATCA
AATTCACCACCATCTATCATGGACGATGTGCCTACTCCGTTCAATCCTCCCGCAAG




**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: