MlSTS5065

Genetic marker
Map(s): Not Mapped
Forward primer: ATGCTCATGGTGGGAAAGG
Reverse primer: CTTATCGGCAGGACAAAACC
Tm: 60.9
Physical marker
Overgo sequence fw: GTGCAGCGTTGTCTGCGGGAGCTT
                ||||||||
Overgo sequence rv:                 CCCTCGAAAACTACGACAATAAAC
Tm: 65.4
Set: E / F
Pools: 1,9,11 / 3,9,11
View Map
Sequence
Unigene: MlU472 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 2-150 bp
AAGGCTTATGGTGTGAATGTTGTGGTGGCAGTTAATATGTTTTCGACGGATTCCAAAGCTG
AGCTTAATGCTGTGAGAAGTGCAGCGTTGTCTGCGGGAGCTTTTGATGCTGTTATTTG
TACTCATCATGCTCATGGTGGGAAAGGAGCG

>Exon-2 151-297 bp
GGTAGACCTTGGAATTGCAGTTCAAAAAGCCTGTGAAAGTGTTACACAACCTTTGAAGTTT
TTGTATCCTCTGGATATAAGTATCAAAGAGAAAATAGAGGCAATCGCAAAGTCGTATGGT
GCCAGCGGAGTCGAGTATTCAGAACAG

>Exon-3 298-572 bp
GGCGGAGAAACAGATTGAGATGTACAGCAAACAAGGATTTTCGGGTCTGCCAATATGCATG
GCAAAGACACAGTACTCGTTTTCACACAATGCGTCGGAGAAGGGTGCTCCTAGTGGTTT
TGTCCTGCCGATAAG
AGATGTGAGGGGAAGCATTGGAGCTGGTTTCATCTATCCTTTAG
TCGGGACTATGAGTACAATGCCTGGTTTACCGACTAGACCTTGCTTTTACGACATTGATA
TCGACACCGAAACTGGAAGAGTCATCGGTCTTTCTTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: