MlSTS5064

Genetic marker
Map(s): Not Mapped
Forward primer: GGGGATTTCTCCCCTTGC
Reverse primer: GTCGAACCGATTGATTTATGG
Tm: 61.7
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU465 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 73-376 bp
AATAATTAATATAAAGAGTTACCCTCTTAATTGTAGCATATGCTAGTTTCAGTCTGGAATC
TTTCTGCTTACGGCTCAATGGCCTCCCTTTAGCCGAAGGATCTCTATTTTCCCTCACATC
AGCCAACTTCCAAATGCAGCATCTCGATTCTGTTTCGATGGAATCCAGAAAGTAAACTCC
GCTCTTTTCTGGGCATTTAGTATTTGATGGATCTTCAATATAGCTTACTACCATTGGCAT
CTCTTTGAACCTCGACAGGTCATCGGGTACTCTCAGTAGTCGATCCGCACCAGGACTCGA
TACT

>Exon-2 377-485 bp
TTCAAGAGCTAGATCATCGGGGATTTCTCCCCTTGCACCAATTTCATCCAGTTTTTTCT
TGTATTGGCGGCTAAATGCCTCGATCTCCTCCATTGAGGGGCACCCGAATT

>Exon-3 486-658 bp
TCATTTGAAAGTTTATCTAGTCTCACATAAATGTACCCTCGTGGAGATGTTTTAAACGCAT
AGAGCTCCAAATCTTCACCAAACTCTAGCAGCACTTCTTGAGCTATGGATAATGCTCTTT
CCCCCCACGAGCAATTTTGTAGAACAAATCCACCACCATCACCACCATCTCCA

>Exon-4 659-711 bp
AACCTCAGGGTCAGCTTCATCCTCTTCCTCCCATAAATCAATCGGTTCGACTTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: