MlSTS5063

Genetic marker
Map(s): Not Mapped
Forward primer: AGATTCCGCCAAGACACG
Reverse primer: GTGTTCGGCTTGAGAAGACC
Tm: 59.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU464 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 190-415 bp
ACTCACTGGCGATTTTCAATAGCTCTTCCCATGTGGTAAACTTTTCTCTCGGTTTGTTTTT
CAAATTTCCGCGCCTTTTCTCTTCAAGATCGATTTTTTCCCAGGCATCAAAGGGTACAAC
TCGAGTATTCCTACTGTCCAGTAACTGCAACAGTCCCTCTCTGCCAGGCTTTAGCGAGTT
AGACGTTAATACCCCTTTATCAATGTCGTCTGAGATGCATGCAATA

>Exon-2 416-561 bp
AGTTTCTTCAGCACAATAAAGGTTTGTACCAATAATTCCAGTTGGTCCTCTCTTTAACCAC
CCACACACATATAAGCCTGTCTCGTATTGCATATCACCTTGTGAAGATTCCGCCAAGAC
ACG
ACCTCCAAGATTTGGAACGATTCC

>Exon-3 562-629 bp
CATTGTAGTTGTCAAATGGTAAACCATCGATAGCTACTGATTTGTAACCAATACTCTTCAG
TGCTAACC

>Exon-4 630-690 bp
CCGCATGATATGTCCTCGTATACTTCTGTACCAACAGCCACCTGCTTCATTGATTCATCTC
C

>Exon-5 691-886 bp
CTTTAAGAGTGGTCTTCTCAAGCCGAACACTACCAAGATGACCACTTCTATCATCCGAC
TCTAGAAATCTGTCTGGCTTGTGAAAGAAAACAAAGTGGAGTTCGCATTGACCTGGAACA
GGAGCATGCCCTGTCGTAACTGCTTTAGAGAGCAGTTCATACACCCGCCTCCTGATCCTG
TTATTCTTCATTTCTATC

>Exon-6 887-948 bp
CTCATCAGCAGGTGTTGTAACTAGATCAGCTTGTTTGATATGAATAACCAAATCTCTAATT
CC

>Exon-7 949-1022 bp
CGAGAATTTCTCTTAGTTCTTTTGCAGTACATGCTGCTTGTACAGGTCCACGTCTTCCAAC
CAAATAAACTTTCC

>Exon-8 1023-1132 bp
CTTATAGTACTCTCTTCCAAAGCAGCTAATGCATGGGACGCAATATCTGTTCTTGCCAATT
CCGCTGTTGGCCTTAACAGAATTCTAGCTACATCAAGAGCAACATTACCC

>Exon-9 1133-1249 bp
CTGACCAAGAATAACAGCAGTATCAGAGCTTTTTAAGTCAGGAGCAAGATTCCTGCAGTCA
GGATGCCCATTATACCACCAAACGAACTCTCTGGCAGCATATATACCAGCCAACTCC

>Exon-10 1250-1303 bp
CTCCCCAGGAATGCCAAGAGATCTGTCACTTTCTGCGCCATAGGCAAGCACCACC

>Exon-11 1304-1350 bp
CCCATTATACATCTCACGTAGCTCAGGCAAAGTTACCGAGGATCCAAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: