MlSTS5062

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)7 14.80cM

Forward primer: CCACTTGTTCCCATTTCAGC
Reverse primer: TACCGTTGGAGAGGATGAGG
Tm: 60.5
Physical marker
Overgo sequence fw: GGTTCTCCTTTGAGAGGATGGTAT
                ||||||||
Overgo sequence rv:                 CTACCATAGACCTGAAAACGTCGG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1
MG__Bb078L21
MG__Bb091I23
MG__Ba058L01
MG__Ba022F05
MG__Ba048B12
MG__Ba046J22
MG__Bb087I01
MG__Bb088C24
MG__Ba042B24
MgFPC1135
MG__Bb030I04
MG__Bb089G10
MgFPC1156
MG__Bb025F05
MG__Bb034M06
MgFPC681
MG__Ba066H17
MgFPC721
MG__Ba087L11
MG__Ba059K03
MG__Bb042A11
MlFPC1267
ML__Ba027K12
MlFPC699
ML__Ba072M13
Set: E / F
Pools: 1,8,15 / 3,8,15
View Map
Sequence
Unigene: MlU460 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 170-239 bp
CAGCTTTTCGGCGGCCAACACGAGCAACGAAACCTGCCTTGATTGGAGCAACCGATCTTCC
AGAACCACAC

>Exon-2 240-325 bp
CTTTTCACATCTCAGAAAGAAGAGACGGTTCTCCTTTGAGAGGATGGTATCTGGACTTTT
GCAGCC
ATTGCATATGACATACTCATT

>Exon-3 326-468 bp
TGATATATCGTCGCAGAATTCCCTCAAAATTCTTGGGAGCAAACCTCCCTTTGACCACCAA
TCTTTGTTGTCCATCCAGAGACCCACTTGTTCCCATTTCAGCCAGCAAGAAAGTCATG
ACATGTTCGGGTTGCCTATGCATTG

>Exon-4 469-614 bp
GTTTTGCAGAGATCCATGAAATTCACGAAAACAGTTTTCTTTGTGCCTTCACGAAGCACTT
GAGGAGGCCTCATAACTGTTCTGCGCCGATCTCCAGCAAGCTCAGGATTATTTTCACGGA
GTATGTTGAATACTCGCCCAAGAAGC

>Exon-5 615-703 bp
CTCTTCATATTCATAATCCCTGTCACTTCCTTCCCATGGATATTGTTGCAACACAATTCCT
TCTCCTTCCTCATCCTCTCCAACGGTATC

>Exon-6 704-755 bp
CATCCAATTCTTCCAAATTCTCTTTTTCTTCATTTAGAAGATCAGTATGTGCT

>Exon-7 756-811 bp
TGCTTTTTTCTTTTTCTTCTTGAGACCAGCAAATGAAGTTTCAAGACCATCAGAAAC

>Exon-8 812-926 bp
CAGATAAGCTCTCAGTTTTCTCAGCTAAAGTATCAACAGAGTCCACTTCAGCTAGATCTTG
AGCCACTGGCTTCTTCTTCTTTTTCTTTTTTGTTGGGTCAAATGGAGCTATATCT

>Exon-9 927-946 bp
TGTGACATCGTCTTTAATCTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: