MlSTS5061

Genetic marker
Map(s): Not Mapped
Forward primer: GCAAGCATGGCATAGTACTCG
Reverse primer: TGCTCTTGTGATGAAGAGTGG
Tm: 60.8
Physical marker
Overgo sequence fw: TCGGAAATACTTCCCGCAGGCTGT
                ||||||||
Overgo sequence rv:                 GTCCGACAAGGGTCTAGTTGTAAC
Tm: 65.4
Set: F
Pools: 2,7,14
View Map
Sequence
Unigene: MlU450 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 225-266 bp
TTCACTGATCTCCAGGCAAAGACTTGATGATATCCGAATCACC

>Exon-2 267-335 bp
CAGGGTCAACAATGCTGAGGCATGAAACTCGGAAATACTTCCCGCAGGCTGTTCCCAGAT
CAACATTG
TT

>Exon-3 336-437 bp
TTCCACTGTAATGATGGACACCAACTTTAGCAAGCATGGCATAGTACTCGATCTCGGAT
TTCCTCAGAGGCGGGCAGTTGTTCGATATCAATATCAACTTACC

>Exon-4 438-543 bp
CTTTGGAGCTCCTGAGAGTCTTGAGAACAGTCTTGTAACCAAGAGTGTATTTTCCACTCT
TCATCACAAGAGCA
AGCCTGTTGTTGATACTCTCATGGGTCTTCTTC

>Exon-5 544-563 bp
CGTCTTTTTGCCGGCGGTCAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: