MlSTS5057

Genetic marker
Map(s): Not Mapped
Forward primer: TCAAAAACTCGAGGCACTCC
Reverse primer: AGGGGTCGATCTTTTCATGG
Tm: 60.4
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU412 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-28 bp
GTATCCTCGATTCATCCAGTAAAGTTTGT

>Exon-2 29-183 bp
TATTTGTAGAGCATGTCGAAGATTTTCCTCCTCCTCCAGTTGAGATCTTCGAGTGCTTTTA
GGACACCTTCGTGTATTCGTTCAAAAACTCGAGGCACTCCTGCCAAAAACGTCGGCTT
TAACTCCATCAGATCATCCTTTAATTCATTTATATCC

>Exon-3 184-294 bp
CCCATGATAGTAGCCAACAGAAGCACCCTTGTGAAAGAAATATTCTTCGATCATACGATCA
AGAATGTGAGCGAGGGGTAGGAATGATATATACACATCGTCCACCGTCATC

>Exon-4 295-462 bp
CTTATCTTCAAATTGCTCCATGAAAAGATCGACCCCTCTTATATTTGTCGAAATGTTTT
CGTGGGTCAATATGACACCTTTAGGGTCCCCACTGGTGCCGCTCGTGTACATAATTGTGC
ATATATTAGATGGCTTCGGCGGAGAAATCTCACTCGGATTTTCTTTTCCC

>Exon-5 463-597 bp
CATTTCAAGAAACTCGTTCCACGGACTCGTTTTTATGCCAATAGCAGCAGCTTTGTCAACC
TGTTCCTCTGTCAGAAAAGTGAAGCAAACAACCAGTTTTAGCCTCCGAGCATGACTGCAT
TCAGGATTGAGAAGT

>Exon-6 598-674 bp
TTCTTTCACTTTCTTATCTTGAACGAAGACAACATCGATCTCTGCGTGATCTAATATGTAG
TTAACAGCTCCTGGCCC

>Exon-7 675-723 bp
CGAGTGTATCGTATAGCGGAACACAGATTAAGCTGTGGGCGGCGCATGCC

>Exon-8 724-780 bp
CTCCATAGCCACAATCCACTGAGGACAATTCGATCCGTAAATGCCTATCCGAGCACCA

>Exon-9 781-870 bp
AGGTTCGATACTGTGTGCACGCAACGCAGAGCCGCAATGCAAAGTTTCTTCGTACACTTGT
TTGTAAGTTTTCCAAATATAAGGCCCCCAC

>Exon-10 871-934 bp
CTTCTCGTTTATCAACTCACGCCACCCCAGCATCCTGTTTTCAGAATGTTTTTCTACCGAT
GCTC

>Exon-11 935-1082 bp
CTGAAAACATCCCAAGCAGTAGATAAACTAGGATCGACGGGCGGATAAGCATCTTCGGCGA
GTAGATTCCGATAAACGGGACCCACGGATAGTTGTCCATCTCCACTACTCCTCTTTCCTT
CTTCTACCTTCACTGCAAATTTCTTCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: