MlSTS5056

Genetic marker
Map(s): Not Mapped
Forward primer: CGACGATCTTCGTTTTACCG
Reverse primer: GTCCCAGCCATACTCATTCC
Tm: 60.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU401 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 153-354 bp
GCTGAGAAGCTGATTCGAGATCTTAACTTGTTCCCGAATAAAGCGTTCAATATCATCGAC
GACGATCTTCGTTTTACCG
ACGCGCCGAAGATCGTCGAGAGGCGATTTAAGTTCCCGAA
TTTGGTCGATCCTAGCGGACTTTCAGCTGATGAACTAGGTCATCATGCCGGTTATTATCA
GATTGAGCATTCTCATGGCGCCAG

>Exon-2 355-523 bp
GGATGTTTTACTTTTTCTTTGAATCACGCAATAGCACCAAAGATCCTGTTGTCATCTGGTT
GACTGGTGGGCCAGGTTGTAGCAGTGAGATGGCTCTTTTCTATGAAAATGGGCCTTTCAC
TATTGCCAATAATTTATCTCTTGTGTGGAATGAGTATGGCTGGGACCAG

>Exon-3 524-643 bp
GGTTTCCAATATTTTATTTGTCGACCAGCCTATTGGGACTGGATTTAGCTATAGCTCTGAT
AAGCGCGACATTCGCCATAATGAAAAAGGTGTCAGTGATGACTTATATGACTTCCTACAG


>Exon-4 644-787 bp
GGCTTTCTTTAAGGAGCATCCTGAACTGGCAGAAAATGATTTTTACATTACGGGAGAGTCA
TATGCTGGACATTATATTCCTGCTTTTGCTGCCCGTGTTCACCAAGGAAACAAAGGAAAA
GAAGGAATTCATGTGAATTTAAAG

>Exon-5 788-938 bp
GGGATTTGCTATTGGAAATGGGCTCACAGATCCAGCAATTCAGTATGGTGCATATGCCGAT
TATGCCCTTGATATGGGTATAATTAAGCAATCTGACCATGATCGTATCAACAAGGTGCTT
CCGGTCTGTGAAACAGCAATAAAGCTTTGTG

>Exon-6 939-1027 bp
GGCACTGATGGGACACTATCTTGCATGGCAGCGTACTTGGTTTGNCACACAATATTTAGTT
CTATCATTGCACGCGCTGGTGATGTGAAC

>Exon-7 1028-1286 bp
CTATTACGATATTAGAAAGAAATGCGAAGGCAGTCTATGCTACGACTTCTCGAACTTGGAG
AAATTCCTTAACCAGAAATCTGTGAGGAGTGCTCTTGGAGTTGGAGATATAGAGTTTGTC
TCGTGTAGCACTAGTGTTTACCAAGCTATGCTTATGGATTGGATGAGAAATCTCGAAGTA
GGTATTCCTGCTCTTCTTGAGGACGGAGTAAAGCTGCTGGTATATGCTGGAGAATATGAT
CTCATCTGCAACTGGCTTG

>Exon-8 1287-1420 bp
GGTAACTCGAGATGGGTCCACGCAATGGAATGGGCCGGTCAGAAAGAGTTTGTAGCATCGA
GTGAAGTTCCTTTTGAAGTTGATGGTTCTGAAGCAGGATTGTTGACAAGCCATGGGCCTC
TCAGTTTCTTGAAG

>Exon-9 1421-1512 bp
GGTACATGATGCTGGGCACATGGTTCCAATGGACCAGCCTAAAGCTTCATTGGAGATGCTG
AAGAGGTGGATGAATGGTTCACTCGCTGAACC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: