MlSTS5052

Genetic marker
Map(s): Not Mapped
Forward primer: CCACTATCAAGAGCGTCAAGG
Reverse primer: TCGAGAGCCTCGTAAACACC
Tm: 59.9
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU359 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 52-116 bp
ATGGCCACTATCAAGAGCGTCAAGGCCCGTCAGATCTTCGACAGCCGTGGTAATCCTAC
GGTCGAG

>Exon-2 117-245 bp
GGTTGATATACATCTATCGAATGGGCTCTGGGCTAGAGCAGCTGTTCCTAGTGGAGCATCC
ACTGGTGTTTACGAGGCTCTCGAACTGAGGGACGGAGGATCCGAGTACCTCGGAAAGG
GTGTCTCCAAG

>Exon-3 246-293 bp
GGCTGTGAGCAATGTCAACAGCATCATCGGACCTGCCCTCGTCGGAAAG

>Exon-4 294-380 bp
GGACCCAACAGACCAGACCGGAATTGACAATTTCATGGTCCAACAACTTGATGGAACTCTG
AATGAGTGGGGTTGGTGCAAGCAAAAG

>Exon-5 381-461 bp
GCTTGGTGCAAATGCCATTCTTGCTGTGTCGCTTGCGTTGTGCAAAGCTGGAGCTGCTGTG
CTCGATATCCCGCTGTACAAG

>Exon-6 462-644 bp
GCACATTGCCAACTTAGCTGGTAACAAGAAGCTGGTTCTCCCTGTTCCTGCTTTCAATGTC
ATCAATGGTGGATCGCATGCTGGAAACAAACTTGCAATGCAGGAGTTCATGATTCTCCCC
GTTGGAGCTTCTTCTTTCAAGGAGGCCATGAAGATGGGTGTTGAAGTCTATCACCATTTG
AAG

>Exon-7 645-782 bp
GGCTGTCATTAAGAAGAAGTACGGTCAAGATGCAACCAATGTTGGAGATGAAGGTGGCTTT
GCTCCCAACATTCAGGAGAACAAGGAAGGTCTCGAACTTCTCAAGACAGCCATTGCCAAA
GCAGGTTACACTGGAAAG

>Exon-8 783-860 bp
GGTTGTTATCGGAATGGATGTTGCTGCTTCTGAATTTTATGGATCGGACAAGACTTACGAT
TTGAACTTCAAGGAAGAG

>Exon-9 861-1055 bp
GAACAATGACGGGTCTGCAAAGATCTCGGGTGACAAGCTCAAAGATCTGTACAAGTCGTTT
GTGTCTGAGTACCCTATCGTCTCGATTGAGGATCCGTTTGACCAGGATGACTGGGAGCAC
TATGCAAAGATGACTGCAGAAATCGGAACTCAAGTTCAAATTGTGGGAGACGATCTCCTT
GTCACCAACCCCAAG

>Exon-10 1056-1247 bp
GAGAGTTGAGAAGGCGATTAAGGAGAAGTCATGCAATGCTCTTCTTCTGAAGGTTAACCAA
ATCGGATCTGTGACTGAAAGTATTGAAGCTGTAAGGATGTCCAAGCATGCTGGTTGGGGT
GTAATGGCCAGTCACCGCAGTGGAGAAACAGAGGACACTTTCATTGCCGATCTCTCCGTC
GGATTGGCTACG

>Exon-11 1248-1304 bp
GGGCCAAATTAAGACTGGAGCTCCTTGCAGATCTGAACGTCTAGCAAAATACAACCAG

>Exon-12 1305-1384 bp
GCTTTTGAGGATTGAAGAGGAACTTGGTTCAGAAGCTGTCTATGCAGGAGCCAGCTTCCGT
GCACCAGTCGAGCCCTACTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: