MlSTS5049

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)3 0.00cM

Forward primer: TGCTCCAGAATAGCGTCTAGG
Reverse primer: GGATTGTTGGGAACAGTTGG
Tm: 59.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU324 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 304-340 bp
TTTAAGACGACTCTACACTTCTGACAAACTTTTTAGCC

>Exon-2 341-427 bp
CTGCTCCAGTGTCAAAAACATGATCACATTCCAAGATCCTAGTCGTCCAAAGTTGGGGATA
AAGCCTTTGTAGAATGCCAAAGGTCCA

>Exon-3 428-502 bp
ATCATTCTTCAAAGTTTTGACAAAGCAATCAAGTGTGTTTTTGTATGTAGAGTCTCCCATC
ATTCTTGACTTGACC

>Exon-4 503-607 bp
CACGTCGACGGGAGATCCTATGCAGACTGCAACGAAACCAGCTCCTAAACCAGATAACAGA
TGGGTGACGATATTGTCTGTGAAACCAGGGATTTTGAGAATTGTC

>Exon-5 608-706 bp
CTGCTTCACTTGATCATAACTAGCTAGTTCAGCAGCATTTATGATAGCATTGCGGCCAACA
TTTGGTCCAAGTCCAGTCCACAAAGCTGCAACTCCTTCC

>Exon-6 707-840 bp
CTGTCTAACAATGGTAGAGTAAGCATTTAGTGCTCCAGAATAGCGTCTAGGCACACCAG
GGGCCAATTTCCCTTCAGCTTGAAGTCTTACTTTAACAAGATCAGTAGGGTTGGCAATGG
TGATTCCCAAAGCACC

>Exon-7 841-919 bp
CAGTCGTGAGACCAGCAAGAATTTTCTTTGATAACGGTACTTCTCCGACATGATCTTTACC
GACGTAGAAGGTTTTAACA

>Exon-8 920-1138 bp
AGGTTCATATAAGCCAATCCTTAAACCTCCGAAGAGACATTGACGATGCAATCCTGGAACA
ATTCCCTTCCATAGAGAAGCTAGCCCTTCTTCTTTTGCAATAGTTCCAACTGTTCCCAA
CAATCC
CTTGTACTTCGGCAAAGACGTCACATCCCCAGCGACAGCTTTCTTCTGCAACT
GAAGCCGGACCTTTGCAGTGTCCAATGGAATCGTACAGATC

>Exon-9 1139-1200 bp
CTCGGCGAAGCAAGCAGCAAAAGCACTGCTGGCGAAAGTTCCGGCGAAGGAAATGTCCGAT
TT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: