MlSTS5047

Genetic marker
Map(s): Not Mapped
Forward primer: TATCTCGCCGGTAACTTTGC
Reverse primer: CACAAAGCGTGAGACAAAGG
Tm: 60.2
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU308 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 86-276 bp
GACGGCGGCGCGGTGGTGGTGGAACCGAAGCCGAAGAAGGGTCTGACTTCGAAGGCGATTG
ACTGGTTGGAATGGGCGTTCGTGAAGATGATGCATGACCCTAAGAAGCCTCTTCACTAT
CTCGCCGGTAACTTTGC
TCCGGTCGACGAGACTCCTCCTCTTACCGACCTCCCCGTCAA
AGGGCATCTTCCG

>Exon-2 277-347 bp
GGAATGCCTCAACGGTGAGTTTGTGAGGGTGGGGCCCAACCCAAAATTTGCTCCAGCTGCT
GGATATCACTG

>Exon-3 348-362 bp
GGTTCGATGGAGATGG

>Exon-4 363-474 bp
GAATGATTCATGGTATGCGCATCAAGGATGGGAAAGCAACCTTTGTCTCACGCTTTGTG
AAGACATCACGACTTAAACAAGAAGAGTTTTATGGAGGACCAAAATTTATGAAG

>Exon-5 475-574 bp
GATTGGTGACATGAAAGGGATGTTTGGACTTTTCATGGTTACCATGCAAATGCTAAGGGCA
AAACTTAAAGTACTCGATGTTTCCTATGGATTTGGTACAG

>Exon-6 575-637 bp
GCTAATACGGCTATAGTATACCACCATGGGAAGCTTCTGGCACTCAGTGAGGGAGATAAAC
CAT

>Exon-7 638-748 bp
TATGCCATCAAAGTTTTGGAAGACGGAGATCTGCAAACCATTGGCATGATGGATTATGACA
AAAGACTGTCGCATACCTTTACTGCTCATCCTAAGGTTGACCCGTTCACAG

>Exon-8 749-933 bp
GGGGAAATGTTTACTTTTGGCTATTCACAAGCGCCGCCATATGTCACATACAGAGTCATAT
CAAAGGAAGGTGTGATGGAGGATCCAGTGCCGATAACGATAGCTGACCCAGTCATGATGC
ATGATTTTGCTATTACTAAAAATTATGCTATTTTTATGGATCTTCCATTGTACTTCAAGC
CAAAG

>Exon-9 934-977 bp
GGAGATGGTGAAGGACAAGAAGTTCATTTTCAGTTTTGATCCTAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: