MlSTS5046

Genetic marker
Map(s): Not Mapped
Forward primer: CCTCGATCCCCATTACAGC
Reverse primer: CCGACGAGTAGATGATGAAGC
Tm: 60.4
Physical marker
Overgo sequence fw: CCCCATTACAGCTGCTACTTGCAG
                ||||||||
Overgo sequence rv:                 TGAACGTCGTTTAGTCGAAGAACC
Tm: 65.4
Set: F
Pools: 2,7,13
View Map
Sequence
Unigene: MlU307 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1053-1054 bp
TTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: