MlSTS5045

Genetic marker
Map(s): Not Mapped
Forward primer: GCATTCTCCCCTTTCATCG
Reverse primer: ATTGGCCATCCAAAAGTCC
Tm: 60.5
Physical marker
Overgo sequence fw: GCTGGAGATAGTGGTCTGCCAACA
                ||||||||
Overgo sequence rv:                 ACGGTTGTTGAACCTGTACCAACT
Tm: 65.4
Set: F
Pools: 2,7,12
View Map
Sequence
Unigene: MlU300 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 439-530 bp
GGTACTTCAACGTGCATTCTCCCCTTTCATCGATCATCTCCACATCAAATGCTGGAGA
TAGTGGTCTGCCAACAACTTGGACATGGTTGA
TGC

>Exon-2 531-649 bp
CATATATAGTATAGTCCATCCATTTCTTGAGTCTGCATTCTGCCCAACAGTTCCACTTTCA
AGATTCCTCCTATGCAGAGAACAGGATCTGGTAGCTTAAACTTTTGCAAGCAGTTATCC

>Exon-3 650-828 bp
CTGAGCCATTGGGAATTCTGGGGACTTATACGTCCATACAAAATTGTCATCAGCAAAATTT
TGAAAATCGAGAAGTTCATCTCTTTCGTCACTTTCTACCTCCGGAGGGACTTTTGGATG
GCCAAT
CTGAAATCTAACAGCCTTGGCTGAATAAATAGGGAAGCCAAACTGAAAATATG
C

>Exon-4 829-1035 bp
CTTGAAATGGATGCACATGAAATTCAGTGATCAGGCATAGATTTGAAGCCAATTTATAAAT
CAATGTCTCCATAGCAGAAGGATTCCTTTCACCCTTGCTCGACCAATACGACGCTCTGTG
GTCTACCCTATCACTTGGTTCCAGAGTGTTCCGGATGCTCTCTTTTGGATAATTATCCGT
ACTTGATGCACAGATAGCACCTGATAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: