MlSTS5044

Genetic marker
Map(s): Not Mapped
Forward primer: TGAGCTCTTTTCCCATTTCC
Reverse primer: GGTAGCCCTCGTCAACTACG
Tm: 59.2
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU298 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 290-335 bp
TCGCTTTCTTAAGCTTAGCTAGCTCTTGTCGAACAACACCAGCCCTC

>Exon-2 336-448 bp
CTTGATCTTTGCAAGCATCAATTTAAAACGGTCAAAGTCAGTTAGAGCAGCTCTTCTCTTC
TGAACAATCAACTTCCTGCCCCATGAGCTCTTTTCCCATTTCCCTTTGACATC

>Exon-3 449-578 bp
CAGCAGCCTCCATTGCAGTAACAAGAATCTTCTTCTTCGGGGATCTTGAGATGTCAATCTT
GATATCAGTAAGAGAAAGCCTCTTGAAGTTCATCTGACTCCTCACCATGTCTGGGGAATC
GACAAGAGCC

>Exon-4 579-682 bp
CCTGTTCTGGTCGATAACGTCGACGATGACGACGAGCTTTCCATAGTCCTTTCCGTAGTT
GACGAGGGCTACC
CTTCCGATCTCGACGTACCTCTTGAAAGGCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: