MlSTS5042

Genetic marker
Map(s): Not Mapped
Forward primer: TATAAATCGCGTGGCATAGC
Reverse primer: TCTTTTGCTTGATGATGACTGC
Tm: 58.8
Physical marker
Overgo sequence fw: TTCTCTCCGATCCCTCTCTCTCCT
                ||||||||
Overgo sequence rv:                 AGAGAGGAAGAAGGCACTGATGTA
Tm: 65.4
Set: E / F
Pools: 1,8,14 / 3,8,14
View Map
Sequence
Unigene: MlU296 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 342-343 bp
GAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: