MlSTS5041

Genetic marker
Map(s): Not Mapped
Forward primer: TCAAGCCCAATAAATGAAGC
Reverse primer: GGAAGCGTCACATTCAACG
Tm: 57.8
Physical marker
Overgo sequence fw: CTTCCGAAACCACTTTGACCTACT
                ||||||||
Overgo sequence rv:                 CTGGATGAGGAGGTTTACCGTCAC
Tm: 65.4
Set: E
Pools: 1,8,13
View Map
Sequence
Unigene: MlU285 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 212-449 bp
ATAATCTCCTCAAGCCCAATAAATGAAGCACTAGTCCAACATAATCGAAGTTGTAAGCC
AATCTTATGAACTCTAGCTTAAAATCGTTCCAAGGAGGGTACCTTGGCTCGAGCTCGGGG
AAGAAGCTTCTATGAAGAACTGCTTTCTCGTGACTGAAAGTGTCGAACGAGTATTTCCCA
TGGTACCTTCCGAAACCACTTTGACCTACTCCTCCAAATGGCAGTGAATCGCATATAA
AC

>Exon-2 450-599 bp
CTGAATAATGGTGTCGTTGAATGTGACGCTTCCGGAAGATGTTTCTTGCAGAATTCGGT
CCTTTAGTTTCTTATCATTGGTGAACGCGTATATAGCGAGAGGCTTTGGTCTAGCATTGA
TGAAGTCGATGCTTTCTTCGATTTTATCGAGT

>Exon-3 600-679 bp
TGTGATGATGGGTAGCAAAGGCCCGAATATTTCTTCCGTCATAATCTGAGCATCTAATGGA
GGATCCAGTAAAATTGTGGG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: