MlSTS5040

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. lewisii x M. cardinalis(2009)7 16.70cM

Forward primer: GTTTGGAGCTGTTGGAATGC
Reverse primer: AGCCACGTGATGTTTACTGG
Tm: 60.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU282 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 248-440 bp
CAGTTTTACTACTCCTGCGTGAGTTTCTCTTAGTCGAGACCAACGGATTATTCTCCTCATC
ATCAACAGGCGCCCCTAATCTGTCAATATCGAAAGACTTAAACACGGGATGCAAGTAAGC
ATCCTGTAAGTAAGCTTTCAAGTTCAAATTTGGCTCCGTAGCCCTCTCCAACGTGTCCTT
CACCATCGTGTCC

>Exon-2 441-674 bp
CTGTAGTGGGAACTTAACAAAAGCTGACTCGAATCGACCCTTGCAAAATCGATGAAACCAG
ATGGTCAAGACAGGTAGTGCAAGCAAGAATGGAGTTGCTTTGGCTATACTTTTAGTGCTC
AGCAATCCCAAAAGCAGAAATTGTGACATCACTAAACCTATAATTACACGGCGATGCACG
CCCGGCCAAAATGCGGCCCCACTCTCGTACTTCTGATCATATACATTGATGATC

>Exon-3 675-999 bp
CTGGTGTCGGAAAACCACATATGAAAAGGCGAAGAAGACGATGATGAAAGGTAGGATTAAT
GGTGTGATGACTGAATATACGAGTCCCAGTAGAAAGTATAGTTGTATACGAGGTTCTGAT
GAGGGGAAATTTATGCAACCAGGGTCCATTGCTTGTTCCCTGTCCTGTTCTGTCTTGACT
AAGAATGCATTCTTTAGGTGGAACACTATTAGAGGAACCAATCTGAGGATCTCTGCAGCT
ATGCCAGCCCAACCATCAACCATAATATATGTAATAAAAAAAGTGGCTTTCATTGGAATG
GCAACACCCACTGTTATTGGGATCT

>Exon-4 1000-1245 bp
TCTGATGGGGACTGGTTGAGAAACGTTTGGAGCTGTTGGAATGCTGCTCCTGTGATGAT
ACTTCCAAAGAAGACATTTACAAGTAAAAAGAAATGATACTTTCCTGCTGATCTTCTATC
CAGAGACGAAAGAGACGTCAGACCTTCAATTTTGGACATTGTCATGATAATCGTTGGAAG
AAGCAACAGGAATATTTTCAGTACAATGCCTGGAAGAAAACCTTGAACAACAGACTTCAC
CTTTTGCT

>Exon-5 1246-1489 bp
TTTTGGATCAACGGTTTCAGGAACGGGAAAACCTTCCCGATGCCATCAATGCTTGCCAATG
ATTGTACAAATGCTATAGGGATCATGAAGAAGAATGTGAGGAAGAACATAGCAACAGTCA
TTAGTAGCTTCTTCACAGCGAGCTCGACATATGGTATTGCGAGATTGTCCCAGTAAACA
TCACGTGGCT
CAGGGGCCCACTCTGTCAGCCAAATAGTTGGATTGCTCGATTGTTGAGT
TTGAGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: