MlSTS5039

Genetic marker
Map(s): Not Mapped
Forward primer: GCTCGGCTTTTCATCTTCG
Reverse primer: CAGAAAGTGCTTTGGTGTGG
Tm: 61.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU281 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 4-28 bp
ATCATTGACTTGTTTAATCAGGACAA

>Exon-2 29-248 bp
AGTATCTTAATGCTATTCAAACAAATGCTCCCCATCTGTTGCGTTACCTGGCGACTGCATT
TATTGTCAACAAGAGGAGGAGGCCGCAGTTTAAGGAATTTATCAAGGTGATTCAGCAAGA
GCAGTACTCGTTTGAAGATCCCATCACAGAGTTTTTAGCATGCATATATGTCAACTATGA
CTTTGATGGAGCTCAAAAGAAGATGAAAGAGTGTGAAGAA

>Exon-3 249-391 bp
AGTTATATTGAATGACCCGTTTCTTGGTAAGAGAATTGAAGAAGGAAACTTTGCCTCTGTA
CCTTTTAGAGATGAATTCCTTGAAAATGCTCGGCTTTTCATCTTCGAGACCTACTGTC
GCATTCATCAGCGCATTGATATGCA

>Exon-4 392-529 bp
AGGTGCTCGCTGAGAAGCTGAATTTGAATTTTGATGAGGCGGAGAGGTGGATACTGAATCT
TATAAGGACATCGAAGCTTGAAGCTAAGATTGATTCCGAGACAGGAACTATTATTATGGA
ACCCAATCATACCAATGT

>Exon-5 530-628 bp
TGTACGAGCAGCTCATTGACCACACCAAAGCACTTTCTGGCCGCACTTATAAATTAGTT
AGTCAGCTTCTGGAACATGCTCAGACGCAGACTGCTCGATA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: