MlSTS5036

Genetic marker
Map(s): Not Mapped
Forward primer: TCAGCGTTTGTGAAACTTGC
Reverse primer: CCGATTTTAAAGTGGATACGG
Tm: 60.0
Physical marker
Overgo sequence fw: CTGTGTGGTAATACGACGCACTCA
                ||||||||
Overgo sequence rv:                 GCGTGAGTTCGATAGTGGGAACAG
Tm: 65.4
Set: F
Pools: 1,8,12
View Map
Sequence
Unigene: MlU252 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 238-545 bp
CTCATGGCTTGAGAGCCAAAGCCAACCCAAACTTGGCGCTCTTGTCAATAGACTTGGTGTC
CACCTCAGTCGAAACAGTGACGAGGGACTTGGGGCGCCATTCGTGCTGGATAAGAGCACT
TGCCTTTCCAAAGTTGTTCAGTCGTGCCTTCACAGTGGTCAATGGGTCCAACGAATGCTG
AGTGCCAACAGTGATGGTGTTCTCGTTGCTCGAGAAGCTATGGGTCACCTCTGCACCAAC
GGCAGTGTTGGTCACTGGGGTCACTGTGTGGTAATACGACGCACTCAAGCTATCACCCT
TGTC
ATTCA

>Exon-2 546-754 bp
AAGGTCACAGCAGCAATAAGATCAGCGTTTGTGAAACTTGCTCCAAAGTTGCATTTGGT
GAAAGCTCCTTCCTTAGTGTCGTAAGACAAATCACTCCCCACAGCAAATAGATTGTTTCC
AACAACACCAGAAAAGTTCACAATGGGGTTAGCAGTCAACCCAACGCTCGAGCTTATCCC
AGCATAGTCATGCAAGTATTGAAGTTCCAAC

>Exon-3 755-841 bp
CTTCCCAGATCTTTGGTCAGGAACTTTAAAGCTTACGATCGTCTTCAGTCCAGGAGCAGGC
TCATCAATCGTGACAGTGGCGAAAAGA

>Exon-4 842-952 bp
ATTGGAACCCGTATCCACTTTAAAATCGGTGGTGACATTCTTATGCTTCAACTGAGTAT
TGATGTCAGCCAAAAACAGATCACCTTTCTTTGTTCCTGTCGAAGTGAGTGTA

>Exon-5 953-1020 bp
AACTCCAGTGGGTGAGTAGGTTGTGAGTGTGAATTTCTGGTCGCTCTGGTAATCCCTGTTA
AGAAGATC

>Exon-6 1021-1068 bp
CTCGAGTTCTTTTGCCGATATCAGAGTATAGACCAGGACCCTTGCCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: