MlSTS5035

Genetic marker
Map(s): Not Mapped
Forward primer: CCGGACTTTTCTACTGGATCG
Reverse primer: CACTCCGTGAATTGGAATCG
Tm: 61.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU242 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 95-211 bp
ATCGCTTTCGGACGATTCGATGACTCGTTCAGCTTTGGCTCAATCAAGGCTTACATCGCCG
AGTTCATCTCCACCTTGCTTTTCGTCTTTGCCGGCGTCGGCTCCGCCATTGCTTACA

>Exon-2 212-462 bp
AACAAGTTGACCTCCAACGCCGCACTCGACGCGCCGGGACTGGTGGCGGTGGCAGTGGCAC
ACGCATTCGCTCTATTTGTGGCGGTTTCCATCGGAGCCAACATCTCCGGCGGCCACGTCA
ACCCCGCAGTCACCTTCGGTTTGGCCGTCGGTGGTCAGATCACCATCCTCACCGGACTT
TTCTACTGGATCG
CCCAGCTCCTCGGCGCCGTCGTCGCATCTTTCTTGCTCAGCTTCGT
CACCGGCGGCTTG

>Exon-3 463-824 bp
GGCGATTCCAATTCACGGAGTGGGAGCTGGTGTGGGAGCGATTCAAGGGGTAGTTTTGG
AAATAATCATCACCTTCGGATTGGTGTACACCGTGTACGCCACCGCAGCTGATCCTAAGA
AGGGCTCCATCGGAACAATCGCGCCGATCGCCATCGGATTCATCGTCGGCGCCAACATCT
TGGCCGCCGGCCCATTTTCCGGCGGATCCATGAACCCCGCCCGATCGTTCGGACCCGCCG
TCGCAAGCGGCAACTTCGCCGGGCACTGGATTTACTGGGTGGGCCCACTCGTCGGCGGTG
GATTGGCTGGGATCGTCTACGACAACGTGTTCATGCACCACGAGCATGCGCCACTCGTCA
GCGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: