MlSTS5034

Genetic marker
Map(s): Not Mapped
Forward primer: TTGCAGCCTTCACAAAACC
Reverse primer: CGAGGCATCGTATGTACCG
Tm: 59.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU233 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 235-307 bp
ATCATTTGCAAACTGTCTTAAGCCTCTTTGCAGCCTTCACAAAACCCGCGATAACCTGC
ATCTCATCCAGTTGC

>Exon-2 308-376 bp
CTCCGACACAAAATGCCTCTGGACAACATCGATGAGTTCCTCCTTAGAAGGGTTACGAATG
GCATTGTCA

>Exon-3 377-439 bp
AAGGTTAAAGTGCAGCAAATATCTCCATAGTGCAGCCATCTCGAGTTTACTCAGGTCCACC
TTC

>Exon-4 440-579 bp
CACAGACCCCTTTGGTGTCGAAACAGAATCTTTAGGGTGAGAGTCACAGGAGAGAGAGTGG
CTAAGAGTCTTGTTAGATGAACCAAGTGAACGGTACATACGATGCCTCGATCTTTGGG
ACTTATGCGCATCATCAAATGC

>Exon-5 580-709 bp
CCATGACTGATCTGTTCCACTGCACTTGCTCAAATTCGAAATCGTCGTCTTCTACTTCATT
CCCCGTTGGAGCTTCAATGACACTTAACGCGTTCCTTTGTAGCTTTACTTCAATCCCGTT
TGTCAGAACC

>Exon-6 710-873 bp
CAGCCAATGCCATCCACCAAGACCAACGGCTTTCTTCACAACGCCGTGAAGCCCAACCAGC
ACCGACTTAGTACGGTTGTTGCCGGTCACCACAACCTTAGTGTGGCGGGGAAGAACGGAA
AGCTCCTCTTCGCTGCTATCGCCGCCGCAGCTGTGAAATTGCGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: