MlSTS5033

Genetic marker
Map(s): Not Mapped
Forward primer: AACGGGATGAGTCTTGAACG
Reverse primer: ATCAACTGTCGCCATTTTCG
Tm: 60.1
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU229 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 145-256 bp
TCTCCATGGTAATAATGCATCGAAGAGACTCTCCTTTCAGCATATAATCAAAAGCTTTGTT
GATCTCTGAGAAAGGCACTCTGTGTGTGATAAATTTCTCCAGCTCCAACTCC

>Exon-2 257-418 bp
CCTGTTCATGTACTTCTCGACGACAGACGGGATATCGCTACGAGGCTTATAGTTTCCGAAG
AAGGTTCCTTTGAGAGTCCTCTCGTTCAGGAAATTAACGGGATGAGTCTTGAACGCGT
CGTCCTTGTTCGGCACTCCCACGAGCACCGCCACTCCCCAACCA

>Exon-3 419-576 bp
ATCGTGAACGCATTCGAATGCCGATATCATTGCGTTAACGTTTCCAGTGCACTCGACGCTG
CGATCGACTCCACCATCAGTCATCTCAGCAATCACCTGTTGAACAGGCTTGTCGTGATCC
TTCGGATTCACAAACTCCGTCACACCAAATTTCTTTGC

>Exon-4 577-1061 bp
CTTCATCGAAACGACTCGTGTTTAAATCAACGCCTATGATCCTCGACGCCCCACAAATTCG
AGCCCCTTCAGCAGCAGCAAGCCCAACAGCACCCAATCCGAAAATGGCGACAGTTGAT
CCCTTCGTCGGTTTCGCAACATTCAAAGTAGCACCAAGTCCAGTCGATATTCCACAACTG
AGGACGCACACAATGTCGAGTGGCGCCTCCGGATTGATCTTGGCGAGACAGCCAACGTGG
ACGACAGTGTATTCGCTGAAAGTCGAAGTTCCGAGGAAATGGTGAATCGGTTTTCCGTCC
TTAGAAAACCTCGTTTTGCCGTCTTCGATCATGACACCTCTCTCTGTGTTTATTCTTAGG
AGATCACACATGTTGCTCTCCGATGATTTACAGTGGCGGCACTCCTTGCATTCTCCGGTG
AACACCGGAAGAACATGGTCCCCAGGTTTCAGATCTGTCACACCTTCTCCTACGCTCTCC
ACTATCC

>Exon-5 1062-1108 bp
CCTCCAGCTTCATGACCGAATATACGAGGAAACAGAGGCGTTTGTCCC

>Exon-6 1109-1245 bp
CTTTGCTTCCCAGAAGTAAACATCGGTGTGGCAAAGGGAGGTGAAGAGAATCTTCAGACGA
ACTTCCATTTTCTGCGGCGGCGCCACCTCCACTTCTTCTATCACCAGAGGCTTCCCTGCT
TCCCATGACACCGCGGC

>Exon-7 1246-1275 bp
CTTTGCAGCGAATAACTTGACCTTCTGTGCT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: