MlSTS5031

Genetic marker
Map(s): Not Mapped
Forward primer: GGCTTTCGACGTAAATGAGC
Reverse primer: GCAAACCCGATTTTGATGC
Tm: 59.9
Physical marker
Overgo sequence fw: CCGGGGTAAGAGCAAGTCAATTTT
                ||||||||
Overgo sequence rv:                 AGTTAAAAGAAGGTGTACCATGGG
Tm: 65.4
Set: E
Pools: 1,8,12
View Map
Sequence
Unigene: MlU219 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 219-462 bp
TTGTAGCTTCCAATGGAGCTGCAGCTCTGGTTGCGATGATCTGCTCGTAAAGATCTCGGAT
CTTCAAACCGATGATAGTTTGGAAAAGACCTGTGCCATTGTTGCTGCCTGGGAAATCAGA
AAGCTTTAACATTTGCTGAGTGATTTCACCGTAGAATTTGGTGGAAATGTTGCTGAGGT
GGCTTTCGACGTAAATGAGC
TCGTCTAGTCTGTCGAATTGCCCGTCCATCTCCAATACC
GAGACC

>Exon-2 463-707 bp
CTCGTTGCCGTAGTAAGTATCAGGGCCGTAGGTGAACTTGATTCCGGGGTAAGAGCAAGT
CAATTTTCTTCCACATGGTACCC
ATGAGATGGTGGATCCTTCATCAAAGAGGTAAACTG
GATTGAAGAACTTTATCCCTTCTTTCATTATCAGTCTCACTCTCAGAACTTTCCCCTCAT
TATCATCTGGAATTAGCTGTGTTGGCAAAACTTCTATCACTGCATCTGCATATTGCTTTT
GTGGATC

>Exon-3 708-792 bp
CAATGTAGGCATCAAAATCGGGTTTGCGTGCTTCAATACTAGCTTTGATGCTTTCAAGA
CTGTGTCCTCTTTCAGCCATGTCCCTC

>Exon-4 793-815 bp
CTGAATTTTCCATGCAAATTTAAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: