MlSTS5030

Genetic marker
Map(s): Not Mapped
Forward primer: GGTGGCATAGGAATGAAACG
Reverse primer: TGGATCCATGTAGATTTGTGG
Tm: 60.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU212 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 18-126 bp
TTTCAGCAAAGGGTGGCATAGGAATGAAACGACCGAGCCCTTGAGATACTNTAAGCTGG
CCTTCATCTAAGACGACATGTCCTCCCATTATGACATATAATGGTACTCCA

>Exon-2 127-283 bp
ATGGCAAACCATACCCTCAAAAATATTAAAATCACAGGCCTGGTGATGAGTTTTAGCAGAG
ATTGTACGAGTTGCATTTGGATCCCAAATAACAAGATCAGCATCTGAACCTACAGCGATT
CGCCCCTTCTGGGGATAAATATTAAATATCTTAGCTG

>Exon-3 284-336 bp
GCGTTAGTACTGGTTACTGCCACAAATCTACATGGATCCATTTTCCCAGATTGC

>Exon-4 337-377 bp
CACACCCTTTTCCCAAATCACAGACATTCTGTCTTCCACTCC

>Exon-5 378-465 bp
CATTAACTCCATTAGGTATGCGTCTAAAATCATCTTTACCCAATGCCTTTTGTTCAGCATT
AAATGTACAGTTATCGGTACCTGTACAT

>Exon-6 466-547 bp
TTGTAGGTCATTGTTTGATAAAAGATCCATCAAATAACCTGGGGTAGTTGTATCTGCTCTA
AGGGGTGGACTCATAACATGAC

>Exon-7 548-635 bp
CCAGCAGCATGGCGCCAACATTTGTTCCAATAATGTGTTCCATCCGTACCTAAACTAGCTG
CTATTGGTTCACCAAAAACTATTTTTCC

>Exon-8 636-680 bp
CTTCCTTCCGTGCCAATGAAACACTATCAGCAGCAGTCTTGCTCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: