MlSTS5029

Genetic marker
Map(s): Not Mapped
Forward primer: CCAGTTCCGCATGAAAGC
Reverse primer: TTTTCCAGATTCACCGATCC
Tm: 60.4
Physical marker
Overgo sequence fw: GGCTTGCACATCGTCTCGTCATTC
                ||||||||
Overgo sequence rv:                 GCAGTAAGAGCACATGAGAGTTCA
Tm: 65.4
Set: E / F
Pools: 1,8,11 / 3,8,13
View Map
Sequence
Unigene: MlU210 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 213-432 bp
GTTAACGGAAGTAACCGTAGAGCTCCAAGAAGCATATGCAGAGGCTCCAAGGGTTAGCGGC
ATCAGTCGTAGGAGCCGTCAGAACAACTCGAAAGAATCTAAACGGAAGAAGGGCGGTGGG
CCCCACAACAGGACACGATGCAAATTGACCCGGCTTGCACATCGTCTCGTCATTCTCGT
GTACTCTCAAGT
TTGTCCAATTATTTCCATCCATCGAACCC

>Exon-2 433-501 bp
CTGAAAATTCCAGTTCCGCATGAAAGCCCTCGATCCGTCTTGTCTAAGTGTATAATGGT
TGCACATCAAC

>Exon-3 502-582 bp
CTGATGACTGTGGCCAATGTCAACCATCCACCACGCAGTGTTTCTCCCGTTTTCCATCCGA
GGGCCTGCAAAAGATGTTCCC

>Exon-4 583-657 bp
CAGGTAACTCCTGGAGACCAAAACCTTAGGATCGGTGAATCTGGAAAATGGGCTGCTTG
CGGTGATAATTACATTC

>Exon-5 658-755 bp
CTTTGATAAGACGGGATTAACCCACTGATGTTCACCATAGGATGTGCCTGCAAAGTACAAT
ACCCCATTGCTATCTCCATCACATATGTACTGGAGTTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: