MlSTS5028

Genetic marker
Map(s): Not Mapped
Forward primer: CTTTTACGCTCCTCCAAACC
Reverse primer: GGCTTAATGATGCCAAACG
Tm: 58.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU192 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 239-341 bp
AACTTTTTGACAGTCCCAGAACTTGTGGCATCGTTGCCCAATACCTTTGAAACCGCTGTCT
TGCATACTCCATGAAATCAAAATCAATTTTGTTAACATGCGCC

>Exon-2 342-439 bp
CGAGATTATTCCCCATAAGCCCCAATGAAGATGGCTTGCAAGAGTATACTTCTCCACGTCC
TGAAGTAATTGCTCCACCTCTAGGTCACTTGGATTGCC

>Exon-3 440-487 bp
CTGAACCACTCAGATAGATTCGCAAGAATCTTTTACGCTCCTCCAAACC

>Exon-4 488-605 bp
C
TGGATATTTACTGTAGTCCAAATTATGTGGGGTTTCAGTATGATAGTCTGCAGCCATCT
CGCAGAAATGATTTGCAATATCAAAGGCTACATGGTTGTAGCTCGCATATTCATAATCA

>Exon-5 606-801 bp
AATTATGGTTATCAGTCTGGTTTCTTCATCCATCATTATGTTTCCATATTGCAAATCATTG
TGGCAGAATCCTACAAGTTGATTACTGGTTGAGAGATTCTTTCTCAGTGCAGATATCTCG
TCTTCGAGGACATTCAAGCGAAACTTTTCAGCTTCTTCTGGGGAAGATAAACGTTTGGC
ATCATTAAGCC
AATTGC

>Exon-6 802-820 bp
CGCAATCTATCCCAGAGAAC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: