MlSTS5027

Genetic marker
Map(s): Not Mapped
Forward primer: AGCTGGCCAATATGAACAGG
Reverse primer: CAACTCAGAACTAAGTCCACAGG
Tm: 60.1
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MlU190 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 237-253 bp
AAACGAACGAAAATCGAC

>Exon-2 254-367 bp
CGTAATGAGCTCCGAAGTCGTTGATTCCAACCCTTACAGTCGATTAATGGCATTGAAACGT
ATGGGAATTGTTGACAATTATGAGGATATTCGTAATTTTTCCATTGCTGTTGTT

>Exon-3 368-496 bp
TGGTGTTGGAGGTGTTGGCAGTGTGACAGCTGAAATGTTGACAAGATGTGGAATTGGAAAG
TTAATTTTGTTTGACTATGATAAAGTAGAGCTGGCCAATATGAACAGGCTGTTTTACC
AACCTCATCAA

>Exon-4 497-565 bp
AGCTGGAATGAGTAAAGTTGAAGCAGCTGAGAGAACATTGAAAGAAATCAATCCTGATGTG
CAATTTGAA

>Exon-5 566-709 bp
AGTCTTTAATTACAACATTACTACAATGGACAACTTTCAACATTTTATGGACAAAATTAAA
ACTGGTGGAAAAACTGAAAATTCTCCTGTGGACTTAGTTCTGAGTTGTGTTGATAATT
TCGAAGCCAGAATGGCTATCAATACT

>Exon-6 710-746 bp
TGCTTGTAATGAATTAGGTCAAGTTTGGATAGAGTCTG

>Exon-7 747-829 bp
GGAGTAAGTGAAAATGCTGTGTCTGGACACATTCAGCTTGTCATTCCAGGAGAGACCCCAT
GCTTTGCTTGTGCCCCTCCTTTG

>Exon-8 830-832 bp
GGTT

>Exon-9 833-904 bp
TGTTGCAACTAAAACTGATGAAAAGACATTAAAGAGAGAGGGTGTATGTGCCGCTAGCCTT
CCTACCACCATG

>Exon-10 905-979 bp
GGCAATTGTTGCTGGTTTCCTTGTACAGAATACCTTAAAATATCTCTTGAAATTTGGAACA
GTCACTCCTTACCTT

>Exon-11 980-1066 bp
TGGCTACAATGCTCTTGAAGACTTTTTTCCAACAATGAGTATGAAACCAAACCCTCAGTGT
GATGATAGATTCTGTCTTAAACAACAA

>Exon-12 1067-1164 bp
AGAAGAATATAAGAAAAGAGAAGCTTTGAAACCAAAAGAAGTTTTACTTGAAGTAGAAGAG
TCTCCAGTTGAACATGAAGAAAATGAATGGAAAATAGA

>Exon-13 1165-1217 bp
AACTGGTGTCTGAAACAAGTGAAGAGGAGCTGAAGGCAGCTACAGGAGACACAC

>Exon-14 1218-1263 bp
CCAATTCTTAGTGAAGGACTCAAGTTGGCATATACTGTTCCAGATAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: